|
| Status |
Public on Mar 27, 2018 |
| Title |
EXR-DERLE1UCSF060 |
| Sample type |
SRA |
| |
|
| Source name |
Bile
|
| Organism |
Homo sapiens |
| Characteristics |
condition: Liver transplant recipient
anatomical location: Entire gallbladder
rna source: total cell-free biofluid RNA
rna isolation kit: miRNeasy (Qiagen)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Low speed centrifugation (5 minutes in 4 C room at 2,000 x g) was performed to pellet cells and cryoprecipitate. Extracellular vesicles were not pre-purified. RNA was isolated using miRNeasy (Qiagen).
Modified TruSeq Small RNA with randomized 4N adapters.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
All FASTQ files were processed uniformly through the extra-cellular RNA processing toolkit (exceRpt), with an adapter sequence of TGGAATTCTCGGGTGCCAAGG and random barcode length 4 (on 5' and 3' ends). Information about exceRpt is available at https://rkitchen.github.io/exceRpt/.
Genome_build: hg19
Supplementary_files_format_and_content: Each processed data file is a core results archive generated by exceRpt. The core results archive contains read counts for alignments to the different transcriptome libraries used by exceRpt (miRNA / piRNA / tRNA / GENCODE annotations / circRNA), taxonomy trees for exogenous rRNA and genomic reads aligned by exceRpt, and a variety of other files generated by exceRpt.
|
| |
|
| Submission date |
Aug 07, 2018 |
| Last update date |
Aug 07, 2018 |
| Contact name |
David Erle |
| E-mail(s) |
david.erle@ucsf.edu
|
| Organization name |
University of California, San Francisco
|
| Street address |
1550 4th Street, Bldg 19B
|
| City |
San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94158 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE112343 |
Large differences in small RNA composition between human biofluids - 10 biofluids |
|
| Relations |
| SRA |
SRX3848843 |
| BioSample |
SAMN08796743 |
