 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 06, 2018 |
| Title |
MethylC-seq_P7_Kidney_EC_R1 |
| Sample type |
SRA |
| |
|
| Source name |
P7 GFP-positive sorted cells from Kidney (vascular ECs)
|
| Organism |
Mus musculus |
| Characteristics |
strain/genotype: Tie2-GFP
age: P7
Sex: Male
tissue: Kidney
cell-type: Vascular endothelial cells
|
| Growth protocol |
Adult mice were housed in our animal facility with 12 h light/dark cycles and food ab libitum. Animals were used for analysis in accordance with protocols approved by the Institutional Animal Care and Use Committee
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA for MethylC-seq was prepared from GFP-positive FACS-sorted cells using the DNeasy Blood and Tissue kit (69504, QIAGEN).
DNA methylome libraries were prepared using a modified snmC-seq protocol adapted for bulk DNA samples (Luo et al., 2017). 20 ng of purified genomic DNA with 0.5% unmethylated lambda DNA spike-in (D1521, Promega) was bisulfite converted using the EZ DNA Methylation-Direct™ Kit (D5021, Zymo) following the product manual and was eluted in 10 µl M-Elution buffer. 9 µl converted DNA was mixed with 1 µl P5L_random oligo (5 µM, /5SpC3/TTCCCTACACGACGCTCTTCCGATCTNNNNNNNNN, IDT) followed by heat denaturing at 95°C for 3 min using a thermocycler. The samples were chilled on ice for 2 min and mixed with 10 µl enzyme mix containing 2 µl of Blue Buffer (B0110, Enzymatics), 1 µl of 10 mM dNTP (N0447L, NEB), 1 µl of Klenow exo- (50 U/µl, P7010-HC-L, Enzymatics) and 6 µl H2O. The samples were incubated using a thermocycler with the following program: 4°C for 5 min, ramp up to 25°C at 0.1°C/sec, 25°C for 5 min, ramp up to 37°C at 0.1°C/sec, 37°C for 60 min, 4°C. A 3 µl enzyme mix containing 2 µl of Exonuclease 1 (20U/µl, X8010L, Enzymatics) and 1 µl of Shrimp Alkaline Phosphatase (rSAP, M0371L, NEB) was added to the samples. The samples were incubated at 37°C for 30 min using a thermocycler. Samples were cleaned-up using 0.8x SPRI beads and eluted with 10 µl M-Elution buffer. Eluted samples were heated at 95°C for 3 min using a thermocycler and were chilled on ice for 2 min. Samples were mixed with 10.5 ul Adaptase master mix containing 2 ul Buffer G1, 2 ul Regent G2, 1.25 ul Reagent G3, 0.5 ul Enzyme G4, 0.5 ul Enzyme G5 and 4.25 ul M-Elution buffer (Accel-NGS Adaptase Module for Single Cell Methyl-Seq Library Preparation, 33096, Swift Biosciences). Samples were incubated at 37°C for 30 min, 95°C for 2 min and 4°C using a thermocycler. 1 µl 30 µM P5 indexing primer and 5 µl 10 µM P7 indexing primer and 25 µl KAPA HiFi HotStart ReadyMix, (KK2602, KAPA BIOSYSTEMS) were added into each sample followed by thermocycling using the following program - 95°C for 2 min, 98°C for 30 sec, 10 cycles of (98°C for 15 sec, 64°C for 30 sec, 72°C for 2min), 72°C for 5 min and then 4°C. PCR products were cleaned up using 0.8x SPRI beads twice. Methylome libraries were sequenced using an Illumina HiSeq 4000 instrument with 5% PhiX DNA spike-in.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
MethylC-seq.bed.tar
|
| Data processing |
Adaptor sequences were trimmed from sequencing reads using Cutadapt 1.11 with parameters -f fastq -q 20 -m 50 -a AGATCGGAAGAGCACACGTCTGAAC -A AGATCGGAAGAGCGTCGTGTAGGGA. We further trimmed 10 bp from both 5’- and 3’- ends of both R1 and R2 reads with parameters -f fastq -u 10 -u -10 -m 30. Trimmed R1 and R2 reads were mapped to the mm10 reference genome as single-end reads using bismark 0.14.4 with parameter --bowtie2. --pbat option was used for mapping R1 reads. Mapped reads were sorted using Samtools 1.3 followed by removing duplicate reads using Picard 1.141 MarkDuplicates with parameter REMOVE_DUPLICATES=true. Reads were further filtered by MAPQ > 20 using samtools view with parameter -bhq20. Methylation level at each cytosine was summarized using call_methylated_sites from Methylpy package (https://github.com/yupenghe/methylpy/).
genome build: mm10
Supplementary_files_format_and_content: bed files (in tar archive on series record) and tar of chromosome-specific files with read counts.
|
| |
|
| Submission date |
Mar 14, 2018 |
| Last update date |
Apr 09, 2019 |
| Contact name |
Mark F Sabbagh |
| E-mail(s) |
msabbag2@jhmi.edu
|
| Organization name |
Johns Hopkins University School of Medicine
|
| Department |
Molecular Biology and Genetics
|
| Lab |
Jeremy Nathans
|
| Street address |
725 North Wolfe Street
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21205 |
| Country |
USA |
| |
|
| Platform ID |
GPL21103 |
| Series (1) |
| GSE111839 |
Transcriptional and Epigenomic Landscapes of CNS and non-CNS Vascular Endothelial Cells |
|
| Relations |
| BioSample |
SAMN08712802 |
| SRA |
SRX3791756 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3040883_MethylC-seq_P7_Kidney_EC_R1.bw |
169.6 Mb |
(ftp)(http) |
BW |
| GSM3040883_allc_MSD14.tar.gz |
4.0 Gb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
