NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2857632 Query DataSets for GSM2857632
Status Public on Jun 30, 2020
Title SW620_RNAseq
Sample type SRA
 
Source name SW620 cell line
Organism Homo sapiens
Characteristics chip antibody: none
tumor stage: Dukes' type C, colorectal adenocarcinoma
treatment: none
Treatment protocol A lentiviral U6-based expression vector containing PuroR-T2A-mCherry was used to express shRNAs. The lentiviral vector was digested by BsmbI, followed by annealed shRNA oligos insertion, to clone shRNA expression plasmids. We used two shRNA targeting sites against FOXA2, as follows: FOXA2-shRNA1: 5’ GAACGGCATGAACACGTACAT 3’ (from Sigma-Aldrich Corporation, TRCN0000014915); FOXA2-shRNA2: 5’ GCAAGGGAGAAGAAATCCATA 3’, as previously described38. shControl: 5’ CAACAAGATGAAGAGCACCAA 3’. Lentiviral vector particles were produced by tri-transfection of plasmids harboring the packaging construct, the transfer vector and the envelope-expressing construct into 293T cells using DNAfect reagents (Cwbio Cat. No. CW0806). Viral supernatants were harvested and used for infections or stored at -80°C. Stable FOXA2 knockdown cell lines were generated by using lentiviral U6-based expression vectors. Stable populations were selected with 2 μg/ml puromycin (Sigma-Aldrich Cat. No. P9620). Knockdown was confirmed by RT-qPCR and western blotting.
Growth protocol SW480 and SW620 cell lines were obtained from China Infrastruture of Cell Line Resources and cultured as described37. Briefly, SW480 and SW620 cells were cultured in DMEM (Gibco Cat. No. C11995500BT) supplemented with 10% fetal bovine serum (Gemini Cat. No. 900-108) and 1% penicillin/streptomycin (Gibco Cat. No. 15140-122). Cells were cultured at 37°C with 5% CO2. Cells used to inject mice were stably transfected with luciferase.
Extracted molecule total RNA
Extraction protocol RNA-sequencing (RNA-seq) libraries were prepared by using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB Cat. No. E7420), according to the manufacturer’s instructions.
The sequencing was performed by Hiseq1500 (Illumina).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 1500
 
Data processing The fastq files from RNA-seq experiments were mapped to the human genome (hg19) by using STAR41 with parameters --outFilterMismatchNoverLmax 0.05.
To measure expression, we calculated the raw counts for each gene by using the analyzeRepeats command from HOMER (http://homer.salk.edu/homer/) with the option “rna” and the default parameters.
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text files include read count and RPKM values for each Sample
 
Submission date Nov 15, 2017
Last update date Jun 30, 2020
Contact name Yang Eric Li
E-mail(s) liyang01133@gmail.com
Phone +1-8589222580
Organization name Tsinghua University
Department School of Life Sciences
Lab Zhi John Lu
Street address Room 2-110, Biotechnology Building, School of Life Sciences, Tsinghua University
City Beijing
State/province Beijing
ZIP/Postal code 100084
Country China
 
Platform ID GPL18460
Series (2)
GSE106920 Tissue-specific transcription reprogramming promotes liver metastasis of colorectal cancer (RNA-Seq)
GSE106923 Tissue-specific transcription reprogramming promotes liver metastasis of colorectal cancer
Relations
BioSample SAMN08027781
SRA SRX3394256

Supplementary file Size Download File type/resource
GSM2857632_SW620_RNAseq.read_cnt.txt.gz 611.9 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap