 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 09, 2018 |
| Title |
023-7 |
| Sample type |
SRA |
| |
|
| Source name |
Plasma exosomes
|
| Organism |
Homo sapiens |
| Characteristics |
gender: M
tissue: Blood (plasma)
viral status: KSHV-/HIV+
age: 46
kshv oral shedding (copies/ml): ND (below detection level)
kshv plasma viremia (copies/ml): ND (below detection level)
hiv plasma viremia (copies/ml): NA (not applicable)
absolute cd4 count: NA (not applicable)
art treatment: NA (not applicable)
|
| Treatment protocol |
plasmas from KSHV+/HIV+ patients were collected after 2 years of ART treatment (lamivudine, tenofovir and efavirenz) , plasma from KSHV-/HIV+ patients were collected before ART therapy
|
| Growth protocol |
NA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A total of 1 mL of plasma was cleared of cellular debris by centrifugation at 3,000 g for 15 minutes at 4°C. The exosomal RNA was then isolated using the Qiagen exoRNeasy Serum/Plasma Midi Kit (Qiagen Germantown, MD). The RNA was then digested with RNase-free DNase I (Epicentre, Madison, WI) and re-purified on RNeasy MinElute columns (Qiagen Germantown, MD).
Template DNA molecules suitable for cluster generation were prepared using the NEBNext Small RNA-Seq Library Preparation Kit (New England BioLabs; Ipswhich, MA) according to the manufacturer’s instructions, except that following the RNA linker ligation, and after cDNA synthesis, the single stranded cDNA was fractionated using a 12% acrylamide-urea gel. cDNA fragments of 57-88 nt corresponding to inserts of 11-41 nt were excised and purified, in order to ensure that molecules with 17-35 nt inserts were recovered. Following the NEBNext protocol, the purified libraries were electrophoresed through a freshly cast 6% native acrylamide gel and library fragments of 128-158 nt corresponding to inserts of 11-41 nt were excised from the gel and recovered by overnight agitation at 37°C at 200 RPM in elution buffer, passage of the eluate through a 0.45 µm filter, and ethanol precipitation. The quality and size distribution of the amplified libraries were determined using Agilent 2100 Bioanalyzer High Sensitivity DNA microfluidic chips (Agilent Technologies; Santa Clara, CA) . Libraries were quantified using the KAPA Library Quantification Kit (Part Number: KK4824- Kapa Biosystems; Boston, MA).
The libraries were pooled at equimolar concentrations and diluted prior to loading onto a Illumina HiSeq Flow Cell v4 on the Illumina cBot cluster station (Illumina Inc., San Diego, CA). The libraries were extended and bridge amplified to create single sequence clusters using the HiSeq SR Cluster Kit v4 cBot. The flow cell carrying amplified clusters was loaded on the HiSeq 2500 sequencing system and sequenced with 50-nt single-end reads using the HiSeq SBS Kit v4. 10% ΦX174 phage DNA was spiked in all sequencing lanes for sequencer calibration. Real time image analysis and base calling were performed on the instrument using the HiSeq Sequencing Control Software v2.2.58. Illumina bcl2fastq v1.8.3 software was used for demultiplexing and production of FASTQ sequence files.
The samples were sequenced on two flowcells: C8B49ANXX and C89J5ANXX in order to generate a total of at least 14 million reads per sample
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
small exosomal RNA
|
| Data processing |
Illumina bcl2fastq 1.8.3 was used for de-multiplexing and production of FASTQ sequence files. The FASTQ sequence files were merged for each sample and then filtered to remove reads that were flagged by Illumina software as low quality.
The FASTX(1) application was used to trim the 3’-end of sequence reads in order to remove the 3’ adaptor sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) ; sequences without any 3’ adapter sequence as well as sequences of less than 17 nucleotides after trimming were removed. A Perl script was used to remove sequences with any amount of 5’ –adapter sequence (AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACGATC).
FASTX was also used to collapse identical reads into single entries retaining the read count for each unique sequence. To filter out any sequencing errors, only sequence reads that occurred at least 5 times were retained for further analysis. Non-redundant sequences were then aligned to genomic (hg19) and mRNA sequence (hg19) using bowtie 2(2); sequences with perfect-match and 1bp mismatch alignments were retained for further analysis.
DESEq2 for read count normalization and differential expression analysis
Fasta files contain reads mapping to the human genome (Hg19) and mRNA database (miRBase 21)
A read count summary was obtained specifically for the YRNA (yrna_result _match .raw) or miRNA (mirna_result_match.raw) species using bowtie 2
The miRNA read count file (mirna_result_match.raw) was used as input data using the DESEq2 software in order to normalize the read counts obtained between the different samples (DESeq2 miRNA normalized read counts.txt)
Genome_build: reference genome hg19/miRBase 21.0
Supplementary_files_format_and_content: tab-delimited text files include normalized read count values for each sample determined by DESEq 2 using the hg19 (genomic and mRNA) reference genome
Supplementary_files_format_and_content: tab-delimited text files (.raw)include total read count values for each sample mapping to known miRNA and YRNA sequences
Supplementary_files_format_and_content: Exosome_mirbaseResultMatchRaw.txt: reads mapped against miRNA (mirbase21)
Supplementary_files_format_and_content: Exosome_yrnaResultMatchRaw.txt.gz: reads mapped against YRNA
Supplementary_files_format_and_content: Exosome_DESEq2normReadCounts.txt.gz: counts
Supplementary_files_format_and_content: Plasma_mirbaseResultMatchRaw.txt.gz: reads mapped against miRNA (mirbase21)
Supplementary_files_format_and_content: Plasma_DESEq2normReadCounts.txt.gz: DESEq2 normalized read counts mapping to miRNA
|
| |
|
| Submission date |
Oct 26, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Serge Barcy |
| E-mail(s) |
sbarcy@uw.edu
|
| Phone |
2068847335
|
| Organization name |
Seattle Children's
|
| Department |
SCRI
|
| Street address |
1900 Ninth Avenue
|
| City |
seattle |
| State/province |
WA |
| ZIP/Postal code |
98101 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE106238 |
KSHV oral shedding and plasma viremia result in significant changes in the extracellular tumorigenic miRNA expression profile in patients exposed to malaria |
|
| Relations |
| BioSample |
SAMN07839234 |
| SRA |
SRX3333174 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2832562_SL142221_match.fasta.gz |
282.2 Kb |
(ftp)(http) |
FASTA |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
