NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2788061 Query DataSets for GSM2788061
Status Public on Jun 14, 2019
Title sham miRNAseq, replicate 1
Sample type SRA
 
Source name anesthesized and sham surgery performed
Organism Mus musculus
Characteristics strain: C57BL6
tissue: cortex
age: 7-8 weeks
biological replicate: replicate 1
reperfusion time point: n/a
library type: small RNAseq
Treatment protocol Sham or MCAO surgery, cortical tissue dissected
Growth protocol standard animal husbandry and breeding of wildtype C57BL6
Extracted molecule total RNA
Extraction protocol Total RNA was extracted using Trizol reagent, precipitated with ethanol, DNase-treated, phenol-chloroform extracted, precipitated once more with ethanol and yields determined by absorption spectroscopy using a NanoDrop (NanoDrop Products).
miRNAseq libraries were generated following Illumina TruSeq small RNA protocol, PCR amplified 140-160bp fragments (15-35bp inserts + adaptors) isolated and purified for 69bp single-end sequencing on MiSeq (Illumina).
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina MiSeq
 
Description sham, replicate 1
S1
Data processing Clipped adapter sequence (TGGAATTCTCGGGTGCCAAGGAACTCC) from demultiplexed reads, aligned to mature mouse miRNA database using novoalign (Novocraft Technologies) applying iterative 3'trimming and retaining only single-hit reads.
Counts of all mature mouse miRNAs generated, difference analysis of gene expression changes was carried out in R (www.r-project.org; [Ihaka and Gentleman, 1996]) using Bioconductor (Gentleman et al., 2004) and the package edgeR (Robinson and Oshlack, 2010) applying generalized linear model methods to account for biological variation across replicates (McCarthy et al., 2012)
Genome_build: mature mouse miRNAs (miRBase)
Supplementary_files_format_and_content: matrix of counts for all mature mouse miRNAs, for each replicate of all conditions, sham(S), contralateral(C), ipsilateral(I), and time points (3-24hr). Input for difference analysis using EdgeR
 
Submission date Sep 20, 2017
Last update date Jun 14, 2019
Contact name Mariko Kobayashi
E-mail(s) mkobayashi@rockefeller.edu
Organization name Rockefeller University
Department Molecular Neuro-Oncology
Lab Robert B. Darnell
Street address 1230 York Avenue
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL16417
Series (2)
GSE104037 AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke [dataset 3]
GSE104053 AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke
Relations
BioSample SAMN07674655
SRA SRX3200380

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap