 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 11, 2018 |
| Title |
15_xf44 |
| Sample type |
SRA |
| |
|
| Source name |
Gravid adult - whole animal
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: N2
genotype: gtsf-1(xf44)
|
| Growth protocol |
Adult animals were bleached and their embryos were hatched overnight in M9 buffer. Synchronized L1 larvae were plated, grown for 63h until adulthood and egg laying onset.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Animals were collected and subsequently digested with Proteinase K. Total RNA was acquired using Trizol LS reagent, according to the manufacturer's instructions. Samples were enriched for sRNAs using a mirVana Kit (Life Technologies #AM1561). Each sRNA enriched sample was treated in three different ways: 1) directly cloned, 2) treated with Tobacco Acid Phosphatase (TAP), and 3) Oxidized. 1 µg of RNA was treated with 5 U of tobacco acid phosphatase (Epicenter) at 37°C for 2 h to digest 5’ tri- and di-phosphates to mono-phosphates. To oxidate sRNAs, 3 µg of sRNA enriched sample was incubated for 10 minutes at room temperature with 200 mM NaIO4, 5X borate buffer (148 mM Borax, 148 mM Boric acid and adjust pH to 8.6) and nuclease-free water to a total of 20 µL reaction volume. Then 2 µL of 100% glycerol were added to stop the reaction for 10 minutes at room temperature. Purified RNA was precipitated with 100% isopropanol and Glycoblue overnight at -20°C. The pellet was washed once with 75% ethanol and dissolved in nuclease-free water. Then, RNA was size-selected between 18- to 30-nt on 15% TBE-urea gel. Purified fraction was confirmed by Bioanalyzer sRNA chip (Agilent).
Small RNA library preparation was based on the NEBNext Multiplex sRNA Library Prep Set for Illumina (New England BioLabs) with slight modifications. To counteract ligation biases, the 3’ and 5' adapters contained 4 random bases at the 5’- and 3’-end, respectively, and were chemically synthesized by BioScientific. Adapter-ligated RNA was reverse-transcribed and PCR-amplified for 14 cycles using index primers. The PCR-amplified cDNA construct was purified using AMPure XP beads (Beckman Coulter). The purified PCR reaction was checked on the Bioanalyzer using High Sensitivity DNA chip (Agilent). Size selection of the sRNA library was done on LabChip XT instrument (Perkin Elmer) using DNA 300 assay kit. Only the fraction containing 140-165 bp was pooled in equal molar ratio. The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read) using on-board cluster generation.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
gtsf-1(xf44) animals, sRNAs were directly cloned
|
| Data processing |
The raw sequence reads in FastQ format were cleaned from adapter sequences and size-selected in the range 18-30 bases (plus additional 8 random bases) using cutadapt v.1.2.1 (http://cutadapt.readthedocs.org) with parameters ‘-a AGATCGGAAGAGCACACGTCT -O 10 -m 26 -M 38’.
Mapping to the Caenorhabditis elegans genome (Ensembl WBcel235/ce11 assembly) with concomitant trimming of the 8 random bases was performed using Bowtie v.1.1.2 (http://bowtie-bio.sourceforge.net) with parameters ‘-p 8 -v 1 -M 1 --best --strata --tryhard --chunkmbs 512 --trim5 4 --trim3 4 –S’. The resulting SAM alignment files were converted into sorted BAM files using Samtools v.1.3.1 (http://www.htslib.org).
Gene annotation in GTF format was downloaded from Ensembl (release 89). Structural reads were considered reads mapping sense to annotated rRNAs, tRNAs, snRNAs or snoRNAs, and these were removed from further analyses using Bedtools v.2.25.0 (http://bedtools.readthedocs.io).
22G and 26G small RNAs, i.e. 22 and 26 base reads starting with G, were extracted from the BAM files with Samtools and Awk. For browser visualisation, the reads were converted into reads-per-million (RPM) normalized bigWig coverage tracks using Bedtools and the UCSC utility bedGraphToBigWig (http://hgdownload.soe.ucsc.edu/admin/exe/linux.x86_64).
Genome_build: WBcel235 (ce11)
Supplementary_files_format_and_content: All mapped small RNA reads in BAM format (.bam files) and normalized coverage tracks of 22G or 26G small RNAs in bigWig format (.bw files).
|
| |
|
| Submission date |
Sep 04, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Emil Karaulanov |
| Organization name |
Institute of Molecular Biology
|
| Lab |
Bioinformatics Core Facility
|
| Street address |
Ackermannweg 4
|
| City |
Mainz |
| ZIP/Postal code |
55128 |
| Country |
Germany |
| |
|
| Platform ID |
GPL13657 |
| Series (1) |
| GSE103432 |
GTSF-1 is required for the formation of an RNA-dependent RNA Polymerase complex in C. elegans |
|
| Relations |
| BioSample |
SAMN07602945 |
| SRA |
SRX3157675 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2771230_15_xf44_26G.bw |
47.6 Kb |
(ftp)(http) |
BW |
| GSM2771230_15_xf44__WBcel235.bam |
119.2 Mb |
(ftp)(http) |
BAM |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
