|
| Status |
Public on Dec 22, 2017 |
| Title |
Limbs_E12_del8-13rXII_CTCF |
| Sample type |
SRA |
| |
|
| Source name |
Whole Forelimbs
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Whole Forelimbs
genotype: delHoxd(8-13)rXII
strain: B6CBAF1
embryonic day: E12.5
antibody: anti-CTCF (Active motif, 61311, 61312)
|
| Growth protocol |
Heterozygous mutant mice were crossed in order to obtain Wt and homozygous mutant embryos.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For the ChIPmentation sample, the protocol was carried out by following Schmidl et al. (Nature Methods, 2015) as well as the detailed versions in http://www.medical-epigenomics.org/papers/schmidl2015/. Forelimbs of four E12 embryos were dissected and lysed as for ChIP-seq samples. Only one fifth of the sonicated product (around 1 million cells) was used for this ChIP. Antibody (CTCF, Actif Motif) incubation was performed overnight altogether with magentic beads. Washes were performed with buffer WBI, WBIII and Tris pH8 as described in (Schmidl et al 2015). Prehetaed Tn5 transposase was added to the sample for one minute at 37ºC. Washes were done in duplicate with buffer WBI and buffer TET (Schmidl et al, 2015). Proteinase K treatment was performed overnight at 65ºC. Sample was purified with QIAGEN minielute columns in 12ul of water. qPCR test procedure was applied prior to PCR library making. For the library making, fourteen PCR amplification cycles were performed using the nextera N708 index and 3ng of final product were obtained and sent for sequencing. The material was sequenced with 50 bp single-end reads on the Illumine HiSeq according to the manufacturer’s specifications.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Whole forelimb mouse E12.5_del(8-13)rXII_ChIPmentation
|
| Data processing |
Library strategy: ChIPmentation
adapters and bad quality bases were removed with cutadapt (ref Martin et al 2011 version 1.8 options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC for ChIP and -a CTGTCTCTTATACACATCTGACGCTGCCGACGA for ChIPmentation).
Then reads were mapped using bowtie2 on the mm10 genome (ref Langmead et al. 2012 version 2.2.4 default parameters).
Bam files were merged when replicates or resequencing were done.
The peaks and the coverage were obtained as the output of MACS2 (ref Zhang et al 2008 version 2.1.1.20160309 command line: macs2 callpeak -t input.bam --call-summits -B). By default, MACS2 only kept one tag at the same location (the same coordinates and the same strand), which would remove all potential contaminants from 4C experiments.
Genome_build: mm10
Supplementary_files_format_and_content: narrowPeak contains the peak calling; BedGraph contains the coverage from macs2
|
| |
|
| Submission date |
Jul 20, 2017 |
| Last update date |
Feb 19, 2020 |
| Contact name |
Eddie Rodríguez-Carballo |
| E-mail(s) |
edgardo.rodriguez@unige.ch
|
| Organization name |
Université de Genève
|
| Department |
Department of Genetics and Evolution
|
| Street address |
4, Boulevard d'Yvoy
|
| City |
Geneva |
| ZIP/Postal code |
1205 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE101714 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes [ChIP-Seq] |
| GSE101717 |
A TAD boundary at the HoxD locus segregates opposing limb regulatory landscapes and their target genes |
|
| Relations |
| BioSample |
SAMN07374621 |
| SRA |
SRX3024496 |
