NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2666790 Query DataSets for GSM2666790
Status Public on Sep 23, 2017
Title 43676 PEA QS s4U-IAA Rep 1
Sample type SRA
 
Source name PEA QS s4U-IAA
Organism synthetic construct
Characteristics molecule subtype: synthetic RNA control oligo containing dme-let7 sequence with s4U at position 9 flanked by 3' and 5' adapter sequences (5L-let-7-s4U-p9-3L)
Treatment protocol template RNA oligonucleotides (5L-let-7-3L or 5L-let-7-s4Up9-3L; Dharmacon) were deprotected according to the instructions of the manufacturer and purified by denaturing polyacrylamide gel-elution.
Growth protocol n.a.
Extracted molecule total RNA
Extraction protocol synthetic RNA control oligo were subjected to IAA-alkylation or control reactions, preciptiated and reverse transcribed; full length cDNA was gel purified, PCR amplified and sequenced
PCR amplification of full length cDNA products
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2500
 
Description synthetic RNA control oligo was subjected -IAA control reaction and preciptiated; reverse transcription was performed with QS, full length cDNA was gel purified, PCR amplified and sequenced
Data processing Basecalls performed using RTA V1.18.64.0
Cutadapt v1.7.1 was used to trim adapters (allowing for default 10% mismatch in adapter sequence) and sequences of 21nt length were filtered.
Adapter trimmed sequences were aligned to mature dme-let-7 sequence (TGAGGTAGTAGGTTGTATAGT) using bowtie v0.12.9 allowing for 3 mismatches and converted to bam using samtools v0.1.18.
ā€œNā€ containing sequences were filtered from alignment. Remaining alignments were converted to pileup format. Finally, fraction of each mutation per position were extracted from pileup. Output table was analyzed and plotted in Excel v15.22 (Microsoft) and Prism v7.0a (GraphPad).
Supplementary_files_format_and_content: tab-delimited text files contain the coverage and mutation counts for each position along the dme-let-7 sequence.
 
Submission date Jun 13, 2017
Last update date May 15, 2019
Contact name Brian Reichholf
E-mail(s) brian.reichholf@imba.oeaw.ac.at
Organization name IMBA
Lab Stefan Ameres
Street address Doktor-Bohr-Gasse 3
City Vienna
ZIP/Postal code 1030
Country Austria
 
Platform ID GPL19604
Series (2)
GSE99969 Thiol-linked alkylation for the metabolic sequencing of RNA [Primer Extension Assays]
GSE99978 Thiol-linked alkylation for the metabolic sequencing of RNA
Relations
BioSample SAMN07225418
SRA SRX2914338

Supplementary file Size Download File type/resource
GSM2666790_43676_PEA_s4U-IAA_QS_R1_muts.txt.gz 678 b (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap