 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 05, 2017 |
| Title |
naive_H3K27ac_plasmid_1 |
| Sample type |
SRA |
| |
|
| Source name |
embryonic stem cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: H9
cell state: Naive
chip target: H3K27ac
|
| Growth protocol |
H9 human embryonic stem cells were cultured on Matrigel coated cell culture plates, using mTesR1 medium (Stem Cell Technology, 05850). Cells were routinely split (ratio 1:3-1:4) using 0.5mM EDTA (Invitrogen, 15575020). For transfection, single cells were obtained by Accutase treatment (Invitrogen, A1110501), in the presence of Rock inhibitor, Y-27632 (10uM, Cambridge bioscience, SM02-10). For conversion to the naive state, cells were split on irradiated MEFs on gelatin coated plates and media was changed to NHSM media, as described by Gafni et al. (Gafni et al., 2013), containing knockout DMEM (Invitrogen ), 20% knockout serum (Invitrogen), human insulin (Sigma, 12.5ug ml-1 final concentration), 20 ng ml-1 recombinant human LIF (Millipore), 8 ng ml-1 recombinant bFGF (Peprotech) and 1 ng ml-1 recombinant TGF-beta1 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM beta-mercaptoethanol (Invitrogen), penicillin-streptomycin (Invitrogen) and small molecule inhibitors: PD0325901 (1uM, ERK1/2i, Axon Medchem); CHIR99021 (3uM, GSKbetai, Axon Medchem); SP600125 (10uM, JNKi, Abcam ab120065) and SB203580 (10 uM, p38i,Abcam ab120638) Y-27632 (5uM, ROCKi) and protein kinase C inhibitor G06983 (5 uM, PKCi, Abcam, ab144414). Cells were 1:10 passaged using TrypLETM (Invitrogen, 12604021) in the presence of Rock inhibitor and maintained for more than 10 passages in NHSM media prior to analysis. All cells were regularly karyotyped and checked for the presence of mycoplasm.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For chromatin immunoprecipitation, 2x10^7 H9 primed or naive hESC were harvested in 9 ml of medium and cross-linked by addition of 270 ul 37% Formaldehyde (Sigma, final concentration of 1%), for 10 min at room temperature under rotation. 1 ml of 1.25 M Glycine was added, cells were incubated on ice for 5 min and 3x washed with ice cold PBS. At this point, cross-linked cell pellets were snap-frozen and stored at -80ᴼC, or immediately processed for sonication. Prior to sonication, cells were resuspended in 1ml TE-I-NP40 (10mM TRIS-HCl pH 8, 1mM EDTA, 0.5% NP40, 1mM PMSF, 1x Protease inhibitor complex (PIC, Complete tablets, 04693116001, Roche)) incubated on ice for 5 min and centrifuged for 5 min at 2500 rpm at 4ᴼC in a refrigerated bench top centrifuge (Eppendorf). Supernatant was removed and nuclei were resuspended in 1 ml ice-cold lysis buffer (50mM TRIS-HCl pH 8, 10mM EDTA, 1% SDS, 1mM PMSF, 1x PIC) and transferred to a 15 ml Falcon tube for sonication, using a Diagenode Bioruptor Next Gen (40 cycles of 30” on, 30” off). After transfer to an Eppendorf tube and centrifugation for 10 min at 13200 rpm at 4ᴼC, chromatin solution was aliquoted and used for immunoprecipitation or snap-frozen and stored at -80ᴼC. A 20 µl sample was taken and served as a total input control. For immunoprecipitation, Protein Dynabeads G (10004D, Life Techology) were washed with PBS and incubated for 6 hours with 5 ug of antibody, at 4ᴼC on a rotating wheel. Antibodies used were: goat-anti-NANOG (AF1997, R&D Systems), rabbit-anti-OCT4 (AB19857, Abcam), rabbit-anti-H3K4me1 (AB8895, Abcam) and rabbit-anti-H3K27ac (AB4729, Abcam); as a control, respective IgG antibodies were used (rabbit-IgG: 10500C, Life Technology, goat-IgG: SC-2028, Santa Cruz Biotechnology). After washing with PBS, antibody-coupled beads were incubated with 200 ul chromatin solution, diluted to a final volume of 2 ml with dilution buffer (167mM NaCl, 16.7mM TRIS-HCl pH 8.1, 1.2mM EDTA, 0.01% SDS, 1.1% Triton-X100, 1mM PMSF, 1x PIC), overnight at 4ᴼC on a rotating wheel. Washing of beads was performed by incubation with ice-cold 1 ml of washing buffer, for 5 min, at 4ᴼC on a rotating wheel, followed by removal of supernatant using a magnetic stand, for each of the following: 2x with wash buffer 1 (10mM TRIS-HCl pH 7.6, 1mM EDTA, 0.1% SDS, 1% Triton-X100, 0.1% NaDeoxychloate), 2x with wash buffer 2 (10mM TRIS-HCl pH 7.6, 1mM EDTA, 0.1% SDS, 1% Triton-X100, 0.1% NaDeoxychloate, 150mM NaCl), 2x with wash buffer 3 (250mM LiCl, 0.5% NP40, 0.1% NaDeoxychloate), 1x with TE 1x with 0.2% TritonX-100 and 1x with TE 1x, after which beads were resuspended in 100ul TE1x. Immunoprecipitated chromatin and total input control were decross-linked, by addition of 3 ul of 10% SDS and 5 ul Proteinase K (20 ug/ul, Roche) and 10 ul RNAse A (50 ug/ul, Roche) to each tube and incubation overnight at 65°C on a shaking thermomixer block, 1400 rpm (Eppendorf). The next day, beads were briefly vortexed and supernatants were transferred to new tubes using the magnetic stand. 100ul of TE1x containing 500mM NaCl was added to the beads and briefly vortexed, after which the supernatant was added to the first fraction of collected supernatant. Following Phenol / chloroform extraction, DNA was precipitated using 1ul glycogen (20mg/ml), 1/10 vol NaOAc (3M) and 100% ice-cold Ethanol, at -20°C for 1 hour, followed by centrifugation at 13200 rpm for 1 hour at 4ᴼC. After a final wash with 70% ethanol, the DNA pellet was dried and resuspended in 50ul H2O. Concentration of ChIP DNA was determined by Qubit measurement following manufacturer’s instructions and sonication was assessed by gel-electrophoresis of total input DNA (target fragment size between 200 and 600 bp).
For ChIP-seq and ChIP-STARR-seq plasmid library generation, 10 ng of ChIP DNA was used as starting material. Using NEB Next ChIP-seq library preparation kit (E6200 or E6240, NEB), DNA was end-repaired, dA-tailed and adapter-ligated according to manufacturer’s instructions. After adapter ligation and purification using AMPure-XP beads (0.8x, Beckman Coulter) and elution into 30ul of 0.1xTE, 25 ul of the reaction product was used for ChIP-seq library preparation, by PCR amplification with Illumina index primers (7335 and 7500, NEB) using the NEB Next Q Hot start high fidelity master mix (M0543S, NEB) according to manufactures instructions (cycle conditions: 98ᴼC 30 sec, (98ᴼC 10 sec, 65ᴼC 75 sec) x15, 65ᴼC 5 min, 4ᴼC hold). After an additional round of AMPureXP bead purification, DNA was eluted in 0.1xTE without further size selection. Quality and quantity of the prepared ChIP-seq libraries was assessed on an Agilent Tapestation. The remaining 5 ul of purified adapter ligated DNA were used for ChIP-STARR-seq plasmid library generation. Therefore, DNA was diluted to a total volume of 10 ul in 0.1xTE and used as an input in 8 x 50ul PCR reactions using Phusion Polymerase, High-fidelity buffer (M0530L, NEB) and primers 147 STARRseq libr FW (TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT) and 148 STARRseq libr RV (GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) (Arnold et al., 2013), which prime on the adapter sequences and add a 5’and 3’ 15 nucleotide homology sequence to the reaction products which are used for Gibson assembly. After PCR amplification (cycle conditions: 98ᴼ 2 min, (98ᴼC 10 sec, 62ᴼC 30 sec, 72ᴼC 30 sec) x 15, 72ᴼC 5 min, 4ᴼC hold), PCR reactions were pooled, purified using AMPure XP beads (1.8x), eluted in 30 ul 0.1xTE and used for Gibson assembly. Therefore, 15 ug of the mammalian STARRseq plasmid (a kind gift of A.Stark) (Arnold et al., 2013) were digested with AgeI-HF and SalI-HF (NEB) for 8h at 37ᴼC, column purified (Nucleospin purification columns, 740609250, Machery-Nagel), eluted in 30 ul elution buffer and used as a vector in a Gibson reaction, using 2 ul of digested plasmid, 5 ul purified PCR product, 3 ul H20 and 10 ul of a home-made Gibson reaction (100mM Tris-HCl, 10mM MgCl2, 0.2 mM dNTP (each), 0.5U Phusion DNA polymerase (NEB), 0.16U 5’ T5 exonuclease (Epicentre), 2 Gibson reactions per library. After incubation at 50ᴼC for 1 hour, Gibson reaction were pooled and precipitated by addition of 1 ul Glycogen (20 ug/ul, Roche, 1090139300), 5 ul NaOAc (3M) and 125 ul ice-cold 100% ethanol, incubation at -20ᴼC for 1 hour and centrifugation for 1 hour at 13200 rpm at 4ᴼC, followed by a final wash in 70% ethanol. After air drying, DNA pellet was dissolved in 10 ul water and used for electroporation into electrocompetent MegaX DH10beta E.coli bacteria (Invitrogen), according to manufacturer’s instructions, using a Biorad pulser. A total of 5 electroporations per library were performed with each 2 ul of DNA. After recovery in 1 ml SOCS medium each, bacteria were grown for 1 hour at 37ᴼC in a bacterial shaker in the absence of antibiotics. Then, the remaining 5 ml of bacteria culture were incubated in a total volume of 2 liter of LB-media supplemented with Ampicillin and allowed to grow for 16 hours in a bacterial shaker at 37ᴼC. Plasmid DNA was isolated using a Qiagen Maxiprep kit according to manufacturer’s instructions and eluted in 500 ul 10mM Tris-HCl, pH 7.4. Concentration was determined by Nanodrop measurement. Plasmid DNA was amplified for sequencing by a nested PCR, using primers detecting the STARR-seq plasmid (160 STARR reporter specific primer for plasmid DNA fw, GGGCCAGCTGTTGGGGTG, and 153 STARR reporter specific primer 2 rv, CTTATCATGTCTGCTCGA*A*G*C, where * represent phosphorothioate bonds) and Illumina index primers.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
plasmid DNA
DNA-seq of ChIP-STARR-seq plasmid library constructed from H3K27ac ChIP in naive hESCs
|
| Data processing |
Library strategy: DNA-Seq
Base-calling using default Illumina software by Edinburgh Genomics
Adapter contaminants trimmed using Skewer
Reads aligned to GRCh37/h19 genome using Bowtie2 (default parameters + “--very-sensitive”)
Only properly paired, concordantly aligning and uniquely mapping fragments
Read counts summed up per unique (chromsome,start-read1,end-read2) coordinate
Genome_build: hg19
Supplementary_files_format_and_content: Read counts summed up per unique (chromosome,start-read1,end-read2) coordinate
|
| |
|
| Submission date |
Jun 02, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Florian Halbritter |
| Organization name |
St. Anna Children's Cancer Research Institute (CCRI)
|
| Lab |
Developmental Cancer Genomics
|
| Street address |
Zimmermannplatz 10
|
| City |
Vienna |
| ZIP/Postal code |
1090 |
| Country |
Austria |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE99629 |
The functional enhancer repertoire of human embryonic stem cells [plasmid DNA-seq] |
| GSE99631 |
The functional enhancer repertoire of human embryonic stem cells |
|
| Relations |
| BioSample |
SAMN07190125 |
| SRA |
SRX2881151 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2648945_naive_H3K27ac_plasmid_1.read_positions.tsv.gz |
40.9 Mb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
