|
| Status |
Public on Aug 23, 2017 |
| Title |
Plasmid_replicate2 |
| Sample type |
SRA |
| |
|
| Source name |
plasmid DNA
|
| Organism |
synthetic construct |
| Characteristics |
sample type: Input plasmid library before transfection
|
| Extracted molecule |
other |
| Extraction protocol |
1ng plasmid library was amplified with PCR using primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (universal primer) and CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTG (Illumina index 7 primer). The PCR products were purified using 0.8 X Agencourt AMPureXP DNA beads, quantified with Agilent DNA1000 Chip (Agilent, 5067-1504) and then sequenced on a HiSeq 2500 (Illumina) with 250bp pair-end sequencing.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Illumina HCS 2.2.68 used for basecalling.
The raw reads were mapped to human reference genome hg19 using BWA version 0.7.12-r1039 with the parameters:bwa mem -M
Fragments of a size ranging from 400bp to 600 bp and overlapped with at least one selected SNP were kept for further analysis using an in-house perl script.
Count the number of fragments overlapped with each SNP site by an in-house perl script.
Genome_build: hg19
Supplementary_files_format_and_content: Tab-delimited files including the counts of fragments overlapped with each SNP site for each Sample.
|
| |
|
| Submission date |
Jan 27, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Xiaoyue Wang |
| E-mail(s) |
pumcwangxy@163.com
|
| Organization name |
Chinese Academy of Medical Sciences
|
| Street address |
5 Dongdansantiao, Dongcheng District
|
| City |
Beijing |
| ZIP/Postal code |
100005 |
| Country |
China |
| |
|
| Platform ID |
GPL19604 |
| Series (1) |
| GSE94140 |
Systematic Identification of Regulatory Variants Associated with Cancer Risk |
|
| Relations |
| BioSample |
SAMN06276400 |
| SRA |
SRX2523184 |
