NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2467293 Query DataSets for GSM2467293
Status Public on Mar 23, 2017
Title cRNA Mrpp3 rep3
Sample type SRA
 
Source name heart
Organism Mus musculus
Characteristics strain: C57BL/6N
knock out: Mrpp3
age: 11 weeks
Extracted molecule total RNA
Extraction protocol Mitochondria were isolated from homogenized hearts and purified by differential centrifugation and RNA was extracted using the miRNeasy Mini kit (Qiagen) incorporating an on-column RNase-free DNase digestion to remove all DNA.
RNA circularization was performed with CircLigase II ssDNA Ligase. To remove any remaining linear RNA an RNase R digestion was performed. RNA was reverse transcribed using Superscript II and the cDNA was extended with Klenow DNA polymerase I and a tagged primer. The tagged cDNA was amplified using the Failsafe PCR system using primers incorporating Illumina index sequences. PCR products were size selected using Agencourt AMPure XP magnetic beads and library size distribution was analyzed by D1000 ScreenTape analysis and then quantitated by qPCR.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
 
Description mitochondrial RNA
Data processing Adapter trimming was performed using cutadapt version 1.10 (cutadapt -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG)
Trimmed pair-end reads were merged by FLASH version 1.2.11 (flash R1.fastq R2.fastq -M 240)
Repetitive sequences within reads by applying Tandem Repeats Finder (TRF) version 4.09 (trf .fasta 2 7 7 80 10 50 200 -h -d). The TRF output file was converted from dat file format to fastq format with Python vesrion 2.7.6 and R version 3.3.1
Alignment to the mouse mitochondrial genome was performed using Bowtie 2 vesrion 2.2.9 (bowtie2 -x --sensitive-local). The soft-clipping mode was used for the alignment, the remaining unaligned parts were extracted based on CIGAR filed information of sam format with Python version 2.7.6 script. The split parts of each read are called “left”, “middle”, and “right”. Retrieved “left” and “right” parts were aligned again to the mouse mitochondrial genome with bowtie2 version 2.2.9, but this time using an end-to-end mode (bowtie2 -x).
The coverage of combined data was found with BEDtools genomecov version 2.26.0 and count per million (CPM) normalized to the library size of all replicates of KO/WT. Intermediate steps were achieved using Python version 2.7.6 and R version 3.3.1.
Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files were generated
 
Submission date Jan 24, 2017
Last update date May 15, 2019
Contact name Stefan J Siira
Organization name Harry Perkins Institute of Medical Research
Department Molecular medicine
Lab Mitochondrial medicine and biology
Street address 6 Verdun St, Nedlands
City Perth
State/province Western Australia
ZIP/Postal code 6009
Country Australia
 
Platform ID GPL16417
Series (1)
GSE94030 Circularized RNA sequencing of wild-type and Mrpp3 knock out mouse heart mitochondria
Relations
BioSample SAMN06255982
SRA SRX2514236

Supplementary file Size Download File type/resource
GSM2467293_KO3_FWD_combined_LEFT.bam.bedGraph.gz 97.6 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_FWD_combined_MIDDLE.bam.bedGraph.gz 105.9 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_FWD_combined_RIGHT.bam.bedGraph.gz 98.7 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_REV_combined_LEFT.bam.bedGraph.gz 66.8 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_REV_combined_MIDDLE.bam.bedGraph.gz 95.2 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_REV_combined_RIGHT.bam.bedGraph.gz 63.4 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_minus_smallRNA.depth.bedGraph.gz 78.5 Kb (ftp)(http) BEDGRAPH
GSM2467293_KO3_plus_smallRNA.depth.bedGraph.gz 89.9 Kb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap