|
| Status |
Public on Mar 23, 2017 |
| Title |
cRNA WT rep2 |
| Sample type |
SRA |
| |
|
| Source name |
heart
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6N
knock out: WT
age: 11 weeks
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Mitochondria were isolated from homogenized hearts and purified by differential centrifugation and RNA was extracted using the miRNeasy Mini kit (Qiagen) incorporating an on-column RNase-free DNase digestion to remove all DNA.
RNA circularization was performed with CircLigase II ssDNA Ligase. To remove any remaining linear RNA an RNase R digestion was performed. RNA was reverse transcribed using Superscript II and the cDNA was extended with Klenow DNA polymerase I and a tagged primer. The tagged cDNA was amplified using the Failsafe PCR system using primers incorporating Illumina index sequences. PCR products were size selected using Agencourt AMPure XP magnetic beads and library size distribution was analyzed by D1000 ScreenTape analysis and then quantitated by qPCR.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
mitochondrial RNA
|
| Data processing |
Adapter trimming was performed using cutadapt version 1.10 (cutadapt -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG)
Trimmed pair-end reads were merged by FLASH version 1.2.11 (flash R1.fastq R2.fastq -M 240)
Repetitive sequences within reads by applying Tandem Repeats Finder (TRF) version 4.09 (trf .fasta 2 7 7 80 10 50 200 -h -d). The TRF output file was converted from dat file format to fastq format with Python vesrion 2.7.6 and R version 3.3.1
Alignment to the mouse mitochondrial genome was performed using Bowtie 2 vesrion 2.2.9 (bowtie2 -x --sensitive-local). The soft-clipping mode was used for the alignment, the remaining unaligned parts were extracted based on CIGAR filed information of sam format with Python version 2.7.6 script. The split parts of each read are called “left”, “middle”, and “right”. Retrieved “left” and “right” parts were aligned again to the mouse mitochondrial genome with bowtie2 version 2.2.9, but this time using an end-to-end mode (bowtie2 -x).
The coverage of combined data was found with BEDtools genomecov version 2.26.0 and count per million (CPM) normalized to the library size of all replicates of KO/WT. Intermediate steps were achieved using Python version 2.7.6 and R version 3.3.1.
Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files were generated
|
| |
|
| Submission date |
Jan 24, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Stefan J Siira |
| Organization name |
The Kids Research Institute Australia
|
| Department |
Precision Health
|
| Lab |
Mitochondrial Medicine and Biology
|
| Street address |
15 Hospital Ave, Nedlands
|
| City |
Perth |
| State/province |
Western Australia |
| ZIP/Postal code |
6009 |
| Country |
Australia |
| |
|
| Platform ID |
GPL16417 |
| Series (1) |
| GSE94030 |
Circularized RNA sequencing of wild-type and Mrpp3 knock out mouse heart mitochondria |
|
| Relations |
| BioSample |
SAMN06255986 |
| SRA |
SRX2514232 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2467289_WT2_FWD_combined_LEFT.bam.bedGraph.gz |
94.3 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_FWD_combined_MIDDLE.bam.bedGraph.gz |
102.3 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_FWD_combined_RIGHT.bam.bedGraph.gz |
94.4 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_REV_combined_LEFT.bam.bedGraph.gz |
65.3 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_REV_combined_MIDDLE.bam.bedGraph.gz |
93.1 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_REV_combined_RIGHT.bam.bedGraph.gz |
60.5 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_minus_smallRNA.depth.bedGraph.gz |
76.9 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM2467289_WT2_plus_smallRNA.depth.bedGraph.gz |
86.8 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
