NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2425166 Query DataSets for GSM2425166
Status Public on Oct 25, 2017
Title C3517: XX d42 DSD gonad
Sample type SRA
 
Source name embryonic gonad
Organism Canis lupus familiaris
Characteristics tissue: embryonic gonad
developmental age: d42
sex chromosomes: XX
pedigree: DSD
Treatment protocol gonadal tissue was dissected from embryos and then flash frozen and stored in liquid nitrogen
Extracted molecule total RNA
Extraction protocol Total RNA was isolated with the RNeasy Plus Mini Kit (Qiagen)
Standard polyA+ RNAseq libraries were prepared with the TruSeq RNA Library Prep Kit v2 (Illumina) by the Cornell Biotechnology Resource Center Genomics Facility
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description C3517_XX_d42_DSD
Data processing Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.5 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 was used to map reads to the Dog CanFam3 reference genome, guided by the CanFam3 annotated transcriptome (Ensembl).
Novel transcripts were analyzed with cufflinks v2.2.1 (cufflinks, cuffmerge) guided by the CanFam3 annotated transcriptome (Ensembl). File: GuidedDiscovery_genes.gtf.gz
Transcripts were quantified with cuffquant v2.2.1 (-max-bundle-frags 5000000 to handle intervals with high read counts). Analyses included annotated genes only (CanFam3 gtf file with Amh added; --no-novel-juncs) and 'discovery' guided by annotated genes (cuffmerge output: GuidedDiscovery_genes.gtf.gz).
FPKM values were generated with cufflinks v2.2.1: cuffnorm was used for analysis of all samples in parallel for both annotated genes only (+Amh) and for the set of novel genes in GuidedDiscovery_genes.gtf.gz (guided by CanFam3 annotated genes); cuffdiff was used to call differentially expressed annotated genes for age-matched XX cohorts at d37 and d43.
Genome_build: CanFam3 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files generated with Cufflinks including FPKM values for all samples (Annotated_genes_FPKM.txt, GuidedDiscovery_genes_FPKM.txt) and differential gene expression analysis, including q-values reflecting multiple hypothesis testing correction, for age-matched XX cohorts at d37 and d43 (XX_d37_gene_exp.diff, XX_d43_gene_exp.diff).
 
Submission date Dec 12, 2016
Last update date May 15, 2019
Contact name Jennifer K Grenier
Organization name Cornell University
Department Biomedical Sciences
Lab Biotechnology Building rm 333
Street address 526 Campus Rd
City Ithaca
State/province NY
ZIP/Postal code 14853
Country USA
 
Platform ID GPL21400
Series (1)
GSE92283 Comparison of gene expression by RNA-seq in canine gonads from embryos at risk of XX Disorder of Sex Development (XX), male (XY) littermate controls, and age-matched female (XX) and male (XY) controls.
Relations
BioSample SAMN06133043
SRA SRX2416465

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap