 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 26, 2017 |
| Title |
11178X6 |
| Sample type |
SRA |
| |
|
| Source name |
Stool isolated from male mice
|
| Organism |
mouse gut metagenome |
| Characteristics |
mouse genotype: ApcMin
mouse environmental conditions (ne-non enriched, ee-environmentally enriched): Environmentally Enriched (EE)
barcode sequence: TAGGCATGGCGTAAGA
linker primer sequence: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
|
| Growth protocol |
Animals were grown in EE and NE conditions and stool was collected when animals were 4 months of age.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Great care was taken to avoid microbial variability that is independent of experimental design. Since the microbiome is transmitted from the dam, female C57BL/6J mice were newly purchased from Jackson labs as dams of all animals in the experiment, Further, animals from each genotype were housed together until weaning, then placed within their respective environment, to avoid non-genetic or environmental effects (Moon et al., 2015). Given the possible confounding effects of coprophagia, each cage contained similar numbers of animals from all 4 genotypes: wild-type, Tcf4Het/+ Apc+/+, Tcf4+/+ ApcMin/+, and Tcf4Het/+ ApcMin/+. Stool was collected from all mice at time of sacrifice from colon during dissection. Genomic DNA was isolated from control and enriched mouse stool samples using QIAamp DNA Stool Minikit (QIAGEN, 51504) following manufacturer’s instructions for stool pathogen detection protocol.
Primers were designed to selectively amplify the V1-V3 bacterial genomic 16S rRNA regions and include adapter sequences compatible with the Nextera XT 96 Index Kit by Illumina. The two primer sequences chosen have been published previously as Bosshard forward and 533 reverse (Table S5; (Bosshard et al., 2002; Chen et al., 2012). Samples were amplified using 2x KAPA HiFi HotStart Ready Mix (KAPA Biosystems, KK2601) with primers at a final working concentration of 1 µM, purified using Agencourt AMPure XP beads (Beckman Coulter Genomics, A63880), and indexed using Nextera XT 96 Index Kit (Illumina, FC-131-1002). Final samples were re-purified using Agencourt AMPure XP beads (Beckman Coulter Genomics, A63880), resuspended in 10 mM Tris, pH 8.5, and pooled at a final concentration of 4 nM.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Microbiome Genomic DNA from Mouse stool
|
| Data processing |
Library strategy: Microbiome sequencing
Sequenced reads were analyzed using Quantitative Insights Into Microbial Ecology (QIIME) tools and MacQIIME software package version 1.9.1 (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime/citations). De-multiplexed fastq files from the MiSeq were assembled using the fastq-join method and all unassembled sequences were discarded. Analysis was performed following de-novo OUT picking protocol. Sequences were binned into a single fasta file by sampleID, and sequences with 97% or greater similarity were grouped into Open Taxonomic Units (OTUs) with Uclust (Edgar, 2010). Representative sequences were then aligned against the Greengenes core set (version 13_8) using PyNAST using the default of minimum sequence length of 150 and minimum percent id of 75% (Caporaso et al., 2010a; DeSantis et al., 2006). Uclust consensus taxonomy assigner was then used to assign taxonomy (Caporaso et al., 2010b; Edgar, 2010). For alpha- diversity analyses, all samples were rarefied to 20,000 OTUs to remove sequencing-depth variation bias. All other taxonomy summaries were calculated in terms of relative abundance using QIIME’s summarize taxa script (http://qiime.org/scripts/summarize_taxa.html).
Genome_build: metagenome
Supplementary_files_format_and_content: tab-delimited text files listing Taxonomic rank, bacteria name, average relative abundance of that bacteria for each condition, standard error of the mean for each condition, number of samples in each condition and a p-value generated using a two-sample t-test with Welch correction
|
| |
|
| Submission date |
Dec 02, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Melinda L. Angus-Hill |
| E-mail(s) |
melinda.angus-hill@hci.utah.edu
|
| Phone |
801-213-4240
|
| Organization name |
University of Utah
|
| Department |
Medicine
|
| Lab |
Angus-Hill
|
| Street address |
2000 Circle of Hope
|
| City |
Salt Lake City |
| State/province |
UT |
| ZIP/Postal code |
84112 |
| Country |
USA |
| |
|
| Platform ID |
GPL22735 |
| Series (2) |
| GSE90801 |
Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model [Microbiome] |
| GSE90802 |
Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model |
|
| Relations |
| BioSample |
SAMN06099646 |
| SRA |
SRX2390115 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
