|
| Status |
Public on Oct 21, 2016 |
| Title |
RRBS_UCLA1_Clone4_XIST_Neg_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Human embryonic stem cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: embryonic stem cells
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
none provided by the submitter
none provided by the submitter
RRBS
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
Reduced Representation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
RRBS UCLA1 5iLAF Clone4 XIST Negative Replicate1
RRBS_UCLA1_Clone4_XIST_Neg.CGmap.gz
|
| Data processing |
RRBS library reads were mapped to the hg19 reference genome using BS-Seeker v2.0.32 (Guo et al., 2013), which called bowtie v0.12.9 (Langmead et al., 2009). Reads with adapter contamination were trimmed. The adapter sequence used for the contamination check was as follows: CGAGATCGGAAGAGCACACGTC, i.e. meCG end repair + A tail + 10.bp of Illumina adapter sequence.
Genome_build: Homo sapiens UCSC hg19
Supplementary_files_format_and_content: CGmap files are produced by BS-Seeker2 and contain C and T counts per cytosine for both strands.
Supplementary_files_format_and_content: The format is fully described here: https://github.com/BSSeeker/BSseeker2#output-files
Supplementary_files_format_and_content: Briefly, each column of the represents the following:
Supplementary_files_format_and_content: (1) chromosome
Supplementary_files_format_and_content: (2) nucleotide on Watson (+) strand
Supplementary_files_format_and_content: (3) position
Supplementary_files_format_and_content: (4) context (CG/CHG/CHH)
Supplementary_files_format_and_content: (5) dinucleotide-context (CA/CC/CG/CT)
Supplementary_files_format_and_content: (6) methylation-level = #_of_C / (#_of_C + #_of_T)
Supplementary_files_format_and_content: (7) #_of_C (methylated C, the count of reads showing C here)
Supplementary_files_format_and_content: (8) = #_of_C + #_of_T (all Cytosines, the count of reads showing C or T here)
|
| |
|
| Submission date |
Sep 22, 2016 |
| Last update date |
Nov 19, 2020 |
| Contact name |
Kathrin Plath |
| Organization name |
UCLA
|
| Department |
Biological Chemistry
|
| Lab |
BSRB 390B
|
| Street address |
615 Charles E. Young Drive South
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90095-1737 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE87235 |
Human naïve pluripotent stem cells exhibit X chromosome dampening and X-inactivation (RRBS) |
| GSE87239 |
Human naive pluripotent stem cells exhibit X chromosome dampening and X-inactivation |
|
| Relations |
| BioSample |
SAMN05805799 |
| SRA |
SRX2185482 |
