NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2224614 Query DataSets for GSM2224614
Status Public on Feb 15, 2017
Title COLO320_rs1800734_genomic
Sample type SRA
 
Source name Colorectal cancer cell line
Organism Homo sapiens
Characteristics cell line: COLO320
cell type: Colorectal cancer cell line
genetic modification: none
library strategy: targeted DNA-seq
Treatment protocol COLO320 isogenic lines (G/G, A/A) were generated by CRISPR-CAS9 site specific mutation. COLO320 (G/A) was mocked with the empty vector.
Growth protocol RPMI medium supplemented with 10% fetal bovine, 100 U/ml penicillin and 100 µg/ml streptomycin.
Extracted molecule genomic DNA
Extraction protocol Libraries were purified using QIA quick column (DNase I-seq, ATAC-seq, Targeted RNA-/DNA-seq, and 4C-seq), QIA minElute column (ChIP-seq) or SPRI beads (ATAC-seq).
Libraries were prepared according to Illumina's instructions.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina NextSeq 500
 
Description Amplicon containing rs1800734; FW primer: TGGATGGCGTAAGCTACA, REV primer: CAGTTCTCAATCATCTCTTTG
Data processing Illumina Casava software 1.8.2 used for basecalling of Hiseq2000 and NextSeq 500 data.
Library strategy (H3K27ac ChIP-seq): mapping: bwa-aln (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01 --broad option
Library strategy (ChIP-seq/Dnase I-seq/Target RNA or DNA-seq): mapping: bwa-aln (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01; Allele-specific read counts: IGV (version 2.3)
Library strategy (ATAC-seq): mapping: bwa-mem (0.7.10-r789), peak calling: macs2 (version 2.0.10.20130306) q=0.01; Allele-specific read counts: IGV (version 2.3)
Library strategy (4C-seq): mapping: bwa-aln (0.7.10-r789), data analysis: R package 'r3Cseq' (version 3.3)
Genome_build: hg19
Supplementary_files_format_and_content: bigWig files were generated using "bam2bw" script (https://bitbucket.org/simonvh/bam2bw/src), bedGraph files were generated using R package "r3Cseq".
 
Submission date Jul 01, 2016
Last update date Nov 11, 2022
Contact name Ning Qing Liu
E-mail(s) n.liu@erasmusmc.nl
Organization name Erasmus University Medical Center Rotterdam
Department Hematology
Street address Wytemaweg 80
City Rotterdam
ZIP/Postal code 3015 CN
Country Netherlands
 
Platform ID GPL18573
Series (1)
GSE83968 The non-coding variant rs1800734 enhances DCLK3 expression through long-range interaction and promotes colorectal cancer progression
Relations
BioSample SAMN05346331
SRA SRX1892865

Supplementary file Size Download File type/resource
GSM2224614_COLO320_rs1800734_Genomic.bw 53.4 Kb (ftp)(http) BW
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap