NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2176507 Query DataSets for GSM2176507
Status Public on Feb 17, 2017
Title total input RNA, ribo-zero rep2
Sample type SRA
 
Source name HEK 293T stably overexpressiong Flag-SIRT7
Organism Homo sapiens
Characteristics cell line: HEK 293T
overexpression construct: Flag-SIRT7
passages: 10~15
Growth protocol HEK293T cells stably overexpressing Flag-tagged SIRT7 were cultured in DMEM supplemented with 10% FBS (fetal bovine serum) and penicillin-streptomycin
Extracted molecule total RNA
Extraction protocol The total cellular RNA was extracted by TRI reagent according to manufacturer's instruction. For the extraction of total SIRT7-RIP RNA, we performed RIP (RNA immunoprecipitation) experiment. Briefly, the lysates were incubated with anti-Flag M2 affinity gel to immunoprecipitate SIRT7 ribonucleoprotein complex (RNP) . Anti-Flag beads were washed extensively and then subjected to proteinase K digestion to release RNA from SIRT7 RNP. RNA associated with SIRT7 was then extracted by standard phenol-chloroform extraction followed with ethanol precipitation. Ribosomal RNA was substracted from both input cellular RNA and SIRT7-RIP RNA during library construction with the Ribozero Gold HMR kit (Illumina).
Directional RNA-seq libraries were prepared from 25-100ng rRNA-subtracted RNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs).
 
Library strategy RIP-Seq
Library source transcriptomic
Library selection other
Instrument model Illumina NextSeq 500
 
Description input
Data processing Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.5 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
bowtie2 v2.2.6 (default params) was used to divide reads into 2 sets: matching and not matching rRNA (and other noncoding, non-polyA+ RNAs such as microRNAs, snoRNAs, snRNAs, etc).
tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map non-rRNA reads to the Human hg19 reference genome (UCSC).
cuffquant (--no-novel-juncs --library-type fr-firststrand) was used to quantify transcripts based on the Human hg19 reference transcriptome (UCSC).
cuffdiff v2.2.1 (--library-type fr-firststrand) was used to call differentially expressed genes based on the Human hg19 reference transcriptome (UCSC).
Genome_build: Human hg19 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files including counts, FPKM values, and p-values generated from Cuffdiff2 when corrected for multiple hypothesis testing
 
Submission date May 24, 2016
Last update date May 15, 2019
Contact name Jennifer K Grenier
Organization name Cornell University
Department Biomedical Sciences
Lab Biotechnology Building rm 333
Street address 526 Campus Rd
City Ithaca
State/province NY
ZIP/Postal code 14853
Country USA
 
Platform ID GPL18573
Series (2)
GSE81840 SIRT7 is an RNA-activated protein lysine deacylase [RIP-seq ribo-zero]
GSE81841 SIRT7 is an RNA-activated protein lysine deacylase
Relations
BioSample SAMN05172292
SRA SRX1798519

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap