NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2086455 Query DataSets for GSM2086455
Status Public on Dec 19, 2016
Title HEK bulk rep2
Sample type SRA
 
Source name HEK293
Organism Homo sapiens
Characteristics cell line: HEK293
Growth protocol HEK293 cells were cultured in DMEM medium supplemented with glutamine and 10% fetal calf serum.
Extracted molecule total RNA
Extraction protocol 1000 HEK-293 cells in 4.5 ul C1 wash buffer (Fluidigm) were lysed with 9 ul of lysis buffer (0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (AGGGTAATCGTCGGTGTCCAT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). The sample was incubated for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C.
Reverse transcription: 18 ul of 1.75 x reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (rGrCrArArUrGrArArGrUrCrGrCrArGrGrGrUrUrGN(6)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 (Fluidigm) loading reagent were added to the lysed cells and the sample was incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C and kept below 10°C until PCR amplification. PCR amplification and barcoding: One tenth of the reverse transcription (3.15 µl, 100 cells) was mixed with 27 µl 1.15 x Kappa KAPAHiFiHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAG<index>ACACTCTTTCCGCAATGAAGTCGCAGGGTTG, indices are Illumina Truseq indices), 1.1 µM biotinylated PCR primer (Bio-TGCGGTATCTAAAGCGGTGAG), reverse PCR primer (1.1 uM, AGGGTAATCGTCGGTGTCCA). For PCR amplification samples were incubated 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Library preparation: PCR products were fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal fragments were isolated with streptavidin beads and Illumina adapter sequences were added by PCR (Primers: AATGATACGGCGACCACCGAGAT, 0.5 μM; AATGATACGGCGACCACCGAGATCTACACCACAGTTGAGTGCGGTATCTAAAGCGGTGAG, 0.125 μM; CAAGCAGAAGACGGCATACGAGAT, 0.5 μM; CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, 0.125 μM).
5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique. Libraries were sequenced with custom sequencing primers. Custom read1 seq. Primer: ACACTCTTTCCGCAATGAAGTCGCAGGGTTG; Custom read2 seq. Primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG; Custom index seq. Primer: CCACAGTTGAGTGCGGTATCTAAAGCGGTGAG
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Description NS20160217_dge_ed1.txt
Data processing Cutadapt-1.2.1 of 3p adaptor 'CTGTCTCTTATACACATCT',
Discarding of trimmed reads with length < 50b,
Filtering of reads not starting with a well formatted HUMI sequence (N6H4) followed by at least 3 'G' before template sequence,
Extraction of UMI and strech of 'G',
Mapping with STAR_2.4.0a versus hg19,
Drop-seq_tools-1.0 dropseq.jar tool for tagging with Gene information from Ensembl release GRCh37.75, then DigitalExpression calling with default parameters (edit distance=1).
Genome_build: hg19
Supplementary_files_format_and_content: NS20160217_dge_ed1.txt: quantifcation file containing for each gene detected in at least one sample the number of mRNA molecules counted for this gene.
 
Submission date Mar 11, 2016
Last update date May 15, 2019
Contact name Kevin Lebrigand
Organization name IPMC/CNRS
Lab Functional Genomics Platform of Nice-Sophia-Antipolis, France.
Street address 660 route des lucioles
City Valbonne - Sophia-Antipolis
ZIP/Postal code 06560
Country France
 
Platform ID GPL18573
Series (2)
GSE79133 HEK293 cells 100 cell RNAseq profiling on Illumina NextSeq 500
GSE79136 A cost effective single cell RNA sequencing approach for the Fluidigm C1
Relations
BioSample SAMN04546659
SRA SRX1629346

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap