 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 19, 2016 |
| Title |
HEK bulk rep1 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293
|
| Growth protocol |
HEK293 cells were cultured in DMEM medium supplemented with glutamine and 10% fetal calf serum.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
1000 HEK-293 cells in 4.5 ul C1 wash buffer (Fluidigm) were lysed with 9 ul of lysis buffer (0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (AGGGTAATCGTCGGTGTCCAT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). The sample was incubated for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C.
Reverse transcription: 18 ul of 1.75 x reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (rGrCrArArUrGrArArGrUrCrGrCrArGrGrGrUrUrGN(6)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 (Fluidigm) loading reagent were added to the lysed cells and the sample was incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C and kept below 10°C until PCR amplification. PCR amplification and barcoding: One tenth of the reverse transcription (3.15 µl, 100 cells) was mixed with 27 µl 1.15 x Kappa KAPAHiFiHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAG<index>ACACTCTTTCCGCAATGAAGTCGCAGGGTTG, indices are Illumina Truseq indices), 1.1 µM biotinylated PCR primer (Bio-TGCGGTATCTAAAGCGGTGAG), reverse PCR primer (1.1 uM, AGGGTAATCGTCGGTGTCCA). For PCR amplification samples were incubated 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Library preparation: PCR products were fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal fragments were isolated with streptavidin beads and Illumina adapter sequences were added by PCR (Primers: AATGATACGGCGACCACCGAGAT, 0.5 μM; AATGATACGGCGACCACCGAGATCTACACCACAGTTGAGTGCGGTATCTAAAGCGGTGAG, 0.125 μM; CAAGCAGAAGACGGCATACGAGAT, 0.5 μM; CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, 0.125 μM).
5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique. Libraries were sequenced with custom sequencing primers. Custom read1 seq. Primer: ACACTCTTTCCGCAATGAAGTCGCAGGGTTG; Custom read2 seq. Primer: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG; Custom index seq. Primer: CCACAGTTGAGTGCGGTATCTAAAGCGGTGAG
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
NS20160217_dge_ed1.txt
|
| Data processing |
Cutadapt-1.2.1 of 3p adaptor 'CTGTCTCTTATACACATCT',
Discarding of trimmed reads with length < 50b,
Filtering of reads not starting with a well formatted HUMI sequence (N6H4) followed by at least 3 'G' before template sequence,
Extraction of UMI and strech of 'G',
Mapping with STAR_2.4.0a versus hg19,
Drop-seq_tools-1.0 dropseq.jar tool for tagging with Gene information from Ensembl release GRCh37.75, then DigitalExpression calling with default parameters (edit distance=1).
Genome_build: hg19
Supplementary_files_format_and_content: NS20160217_dge_ed1.txt: quantifcation file containing for each gene detected in at least one sample the number of mRNA molecules counted for this gene.
|
| |
|
| Submission date |
Mar 11, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Kevin Lebrigand |
| Organization name |
IPMC/CNRS
|
| Lab |
Functional Genomics Platform of Nice-Sophia-Antipolis, France.
|
| Street address |
660 route des lucioles
|
| City |
Valbonne - Sophia-Antipolis |
| ZIP/Postal code |
06560 |
| Country |
France |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE79133 |
HEK293 cells 100 cell RNAseq profiling on Illumina NextSeq 500 |
| GSE79136 |
A cost effective single cell RNA sequencing approach for the Fluidigm C1 |
|
| Relations |
| BioSample |
SAMN04546658 |
| SRA |
SRX1629345 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
