NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2065970 Query DataSets for GSM2065970
Status Public on Oct 06, 2016
Title 4C SexRev KCNJ2TSS
Sample type SRA
 
Source name human skin fibroblasts
Organism Homo sapiens
Characteristics genotype: 46, XX Sex Reversal
viewpoint: KCNJ2 TSS
Extracted molecule genomic DNA
Extraction protocol 4C-seq libraries were generated from microdissected tissues or cells as described previously (van de Werken et al., 2012). DpnII was used as primary, BfaI as secondary restriction enzymes (Csp6I and NlaIII for human samples). For each viewpoint, a total of 1.6 mg of each library was amplified in 8 or 16 PCR reactions, depending on PCR efficiencies. Samples were multiplexed and sequenced with Ilumina Hi-Seq technology. The following primers were used: Sox9-TSS_1 CCACGAAAGTGTGTTTATATTCT Sox9-TSS_2 TGGCTATTGTTTGTAAATCTCTT Kcnj2-TSS_1 CGGTGGTGGAGAGAAAGA Kcnj2-TSS_2 TCACCAAACAACCTCTACAAA LacZ_1 TCCGACTTCAACTGTAGGG LacZ_2 GCAGAGCCATCTATTGCTTA BOR-Sox9tel_1 TTTGACTCCAAGGACCAGA BOR-Sox9tel_2 TGTGTAAAGGCGGACAGA Sox9-TAD_1 AACTGGGTATAGTGTGGAGAGA Sox9-TAD_2 GGACATCAATGGAACATAGC BOR-Kcnj/Sox9_1 AATGCTGTGGACATCCTG BOR-Kcnj/Sox9_2 TCCGTCAAGTTCCATGTG Kcnj-TAD_1 TCTGTGCCAAATGAACTATTCT Kcnj-TAD_2 AGCACCATCTGTCCTCCTAT BOR-Kcnjcen_1 AAGAAGAGGGGCTCAAAAT BOR-Kcnjcen_2 CTGATTGGCATGGGATAGT SOX9-TSS_1 TCCAAGTGTGTAAGTTTGTCG SOX9-TSS_2 AATCTCCTGGACCCCTTC KCNJ2-TSS_1 TTCAGTGAACGTATTTGTTGAA KCNJ2-TSS_2 GAGCGTTTGATGTTTTACCA
Samples were multiplexed and sequenced with Ilumina Hi-Seq technology using 100bp paired-end or single end reads according to the manufacturer´s protocol.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 1500
 
Data processing 4C-seq reads were cleaned of the primer sequence and mapped to a corresponding reference (GRCh37/hg19 or NCBI37/mm9) using BWA-MEM (v0.7.12-r1044) with default settings.
4C-seq contacts were analyzed in the murine region chr11:108500000-115000000 and the human region chr17:67000000-75000000.
To calculate read count profiles the viewpoint and adjacent fragments 1.5 kb up- and downstream were removed. A sliding window of 10 fragments was chosen to smooth the data and data was normalized to reads per million mapped reads (RPM).
To compare interaction profiles of different samples, we obtained the log2 fold change for each window of normalized reads.
Genome_build: mm9, hg19

Supplementary_files_format_and_content: bedgraph files of the coverage and the calculated ratios
 
Submission date Feb 18, 2016
Last update date May 15, 2019
Contact name Daniel Murad Ibrahim
E-mail(s) ibrahim@molgen.mpg.de, daniel.ibrahim@bih-charite.de
Phone 030 84131516
Organization name Berlin Institute of Health
Department Center for Regenerative Therapies
Street address Augustenburger Platz 1
City Berlin
State/province Berlin
ZIP/Postal code 13353
Country Germany
 
Platform ID GPL18460
Series (2)
GSE78067 Pathogenicity of genomic duplications is determined by formation of novel chromatin domains (neo-TADs) (4C-seq)
GSE78109 Pathogenicity of genomic duplications is determined by formation of novel chromatin domains (neo-TADs)
Relations
SRA SRX1592512
BioSample SAMN04503051

Supplementary file Size Download File type/resource
GSM2065970_4C-Ratio-SexRev_vs_Ctrl-KCNJ2TSS-HAF.bedgraph.gz 119.6 Kb (ftp)(http) BEDGRAPH
GSM2065970_4C-SexRev-KCNJ2TSS-HAF.bedgraph.gz 105.8 Kb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap