|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 19, 2016 |
Title |
ESC_4C_Klf4promoter |
Sample type |
SRA |
|
|
Source name |
ES
|
Organism |
Mus musculus |
Characteristics |
target: Klf4 promoter first cutter and restriction site sequence: Csp6i (GTAC) second cutter and restriction site sequence: DpnII (GATC) reading primer sequence: GACAGGACAAGCGCGTAC non-reading primer sequence: GAGATACCTTTCACCAGGGAT
|
Treatment protocol |
For the reprogramming experiments B cells were exposed for 18h to 100nM of -Estradiol (E2) in gelatinized plates seeded with a feeder layer of the MEFs in RPMI medium. After E2 washout, the cultures were switched to serum-free N2B27 medium supplemented with 2μg/ml of doxycycline, IL-4 10ng/ml, IL-7 10ng/ml and IL-15 2ng/ml. B cells were seeded at a density of 500 cells/cm2 in 12 well plates.
|
Growth protocol |
ESCs (E14TG2) were cultured on gelatinized plates in N2B27 media (50 %DMEM/F12, 50% Neurobasal medium, N2 (500X), B27 (1000X)) supplemented with small-molecule inhibitors PD (1 μM, PD0325901), CHIR (3 μM, CHIR99021) and LIF. CD19+ pre-B cells were obtained from bone marrow with monoclonal antibody to CD19 (BD Pharmingen) using MACS sorting (Miltenyi Biotech). The purity of the sorted cell fractions was confirmed by FACS using an LSR2 machine (BD). After isolation, B cells were grown in RPMI medium supplemented with 10% FBS and 10ng/ml IL-7 (Peprotech). All medium contain 100 X L-glutamine, 100X penicillin/streptomycin, 100X nonessential amino acids, 1000X β-mercaptoethanol. All reagents are from Life Technologies unless otherwise specified. Lin- c-Kit+ Sca-1- CD16+/CD32+ CD34+ GMP cells were isolated by FACS sorting using a BD INFLUX sorting machine and culture in STEMSPAN medium (Stemcell technologies) supplemented with 100ng/ml SCF, 50ng/ml IL3, 50ng/ml Flt3L and 50ng/ml mTPO (all from Peprotech). The antibodies used from GMPs isolation were from BD Biosciences.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
0.5-1.0 million of crosslinked nuclei were digested with Csp6I followed by ligation under dilute conditions. After decrosslinking and DNA purification, samples were digested overnight with DpnII and once more ligated under dilute conditions. Column purified DNA was directly used as input for inverse PCR using primers with Illumina adapter sequences as overhangs. Several PCR reactions were pooled, purified and sequenced.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Library strategy: 4C-seq The reading primer was removed from the read seqeunce using the python script present in the bioconductor package fourCseq demultiplex.py reads were mapped using STAR (parameters: -outFilterMultimapNmax 1 -outFilterMismatchNmax 999 -outFilterMismatchNoverLmax 0.1 -alignIntronMax 1 -alignEndsType EndToEnd). Mapped reads were pre-process using the fourCseq package, and tracks of signal were made using the R package fourCseq, applying a running mean over 5 framgments. Genome_build: mm10 Supplementary_files_format_and_content: bigwig, track of signal
|
|
|
Submission date |
Nov 30, 2015 |
Last update date |
May 15, 2019 |
Contact name |
samuel Collombet |
E-mail(s) |
samuelcollombet@gmail.com
|
Organization name |
Ecole Normale Superieure
|
Department |
Biology
|
Lab |
Thieffry
|
Street address |
46 rue d'Ulm
|
City |
Paris |
ZIP/Postal code |
75005 |
Country |
France |
|
|
Platform ID |
GPL13112 |
Series (2) |
GSE71218 |
How C/EBPa creates an elite cell state for reprogramming to pluripotency |
GSE75481 |
How C/EBPa creates an elite cell state for reprogramming to pluripotency [4C] |
|
Relations |
BioSample |
SAMN04301820 |
SRA |
SRX1456145 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1956907_Klf4prom_Klf4prom_ES_1_FragCounts_RPM_rollmean5frag.bw |
20.8 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|