NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1908129 Query DataSets for GSM1908129
Status Public on Dec 07, 2015
Title 4C_HoxD_bait2_serum
Sample type SRA
 
Source name Embryonic stem cells
Organism Mus musculus
Characteristics developmental stage: E14
chip antibody: none
Treatment protocol Serum mESCs were grown in DMEM containing 10% fetal calf serum in presence of LIF, together called Serum medium.
Growth protocol All cell-culture was conducted in feeder-free condition.
Extracted molecule genomic DNA
Extraction protocol Libraries were prepared according to Illumina's instructions.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina NextSeq 500
 
Description 4C PCR product. Barcode: ACAGTTCTGCAAGAAAGCTT
Data processing Illumina Casava software 1.8.2 used for basecalling of Hiseq2000 and NextSeq 500 data.
Library strategy: ChIP-seq. The reads were aligned to build version mm9 of the mouse genome using bwa (version 0.7.12) with default parameters. Only uniquely mapped reads were kept for downstream analysis. Reads from PCR duplicates were also removed. MACS (version 2.0.10.20130306), was used to identify regions of ChIP-seq enrichment over background using parameters --nomodel --broad.
Library strategy: RNA-seq. MMSEQ package was used to infer gene expression levels. Reads were mapped to mouse gene annotation (Ensemble release 67).
Library strategy: Capture Hi-C. The two ends of paired-end reads were mapped to the reference mouse genome (mm9) separately, using BWA MEM (version 0.7.12) with default parameters. Reads were filtered based on mapping quality score (both ends mapQ ≥ 10) and PCR duplicates were removed. Reads were removed if the two ends are from the same DpnII fragment. CHICAGO CHi-C analysis package (http://regulatorygenomicsgroup.org/chicago) was used to call significant contacts. To increase quality, the whole genome was windowed into 5 DpnII site tiles. Virtual baits were created by merging adjacent target regions. Interactions were filtered based on interaction score and number of reads (score ≥ 5 and at least 5 reads).
Library strategy: DNaseI-seq. The reads were aligned to build version mm9 of the mouse genome using bwa (version 0.7.12) with default parameters. Only uniquely mapped reads were kept for downstream analysis. Reads from PCR duplicates were also removed. MACS (version 2.0.10.20130306), was used to identify DNaseI hyper-sensitive sites using parameters --nomodel --broad.
Library strategy: 4C-seq. The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank HindIII sites (fragment ends). Repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on mouse genome mm9.
Genome_build: mm9
 
Submission date Oct 14, 2015
Last update date May 15, 2019
Contact name Shuang-Yin Wang
Organization name RIMLS
Department Molecular Biology
Street address Geert Grooteplein 28
City Nijmegen
ZIP/Postal code 6525GA
Country Netherlands
 
Platform ID GPL19057
Series (1)
GSE72164 Dynamic reorganization of extremely long-range promoter-promoter interactions between two states of pluripotency
Relations
BioSample SAMN04166291
SRA SRX1335178

Supplementary file Size Download File type/resource
GSM1908129_9197_trim.bedgraph.gz 72.7 Kb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap