NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1881532 Query DataSets for GSM1881532
Status Public on Nov 15, 2015
Title cortex CLEAR-CLIP, biological rep 14
Sample type SRA
 
Source name cortex
Organism Mus musculus
Characteristics strain: C57BL6/J
age: P13
tissue: cortex
Growth protocol Mice were sacrificed at indicated age.
Extracted molecule total RNA
Extraction protocol Cortex was dissected into ice cold PBS, triturated by passing twice though an 18G needle, and UV-irradiated. AGO-cross-linked RNA was isolated with the CLEAR-CLIP protocol described in detail in the accompanying publication.
AGO-cross-linked RNA was cloned by addition of pre-adenylated 3' linker and RNA 5' linker, then RT-PCR, as described in the published CLEAR-CLIP protocol. Products were amplified in a second round of PCR that added a 4 nt index (for multiplexing, see above) and 16 nt common primer sequence. Raw files are demultiplexed on the basis of this index, but have not been further modified.
 
Library strategy RIP-Seq
Library source transcriptomic
Library selection other
Instrument model Illumina MiSeq
 
Description protocol: CLEAR-CLIP
complex MW (kD): 130-150
multiplex index: TAGC
Data processing base calling: Casava 1.8.2
quality filtering: minimum quality filter applied for barcode and insert; fastq_filter.pl; -if sanger -f min:0-3:20,mean:20-40:20 -maxN -1 -v -of fasta ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
collapse exact sequences: exact duplicate sequences removed; fasta2collapse.pl; ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
remove 3' adapter sequene: 3' adapter GTGTCAGTCACTTCCAGCGG clipped; fastx Clipper; -l 20 -a GTGTCAGTCACTTCCAGCGG -n; http://hannonlab.cshl.edu/fastx_toolkit/
trim 5' adapter sequence: 5' 20 nucleotides trimmed (NNNNAGGGAGGACGATGCGG, where NNNN is 4 nucleotide index for multiplexing); fastx Trimmer; -f 21; http://hannonlab.cshl.edu/fastx_toolkit/
strip 5' degenerate linker: 5 nucleotide (NNNNG) degenerate barcode stripped and appended to read IDs; stripBarcode.pl; -linker 5 ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
alignment against micoRNA database: microRNA database mapped against sample file (treated as reference genome) to identify potential chimeric reads containing microRNA sequence; Bowtie; -n 1 -l 8 -e 35; http://bowtie-bio.sourceforge.net/index.shtml
extract chimeric read: extract potential chimeric sequence 5' or 3' of mapped microRNA sequence; text manipulation in R; ;
alignment against genome reference: alignment ofpotential chimeric reads against reference genome to identify target sites; Bowtie; -n 1 -l 8 -e 35; http://bowtie-bio.sourceforge.net/index.shtml
collapse PCR duplicates: mapped reads with same 5' end and same degenerate barcode consolidated; tag2collapse.pl; keep-tag-name --keep-max-score --random-linker -EM 30 --seq-error-model em-local --weight --weight-in-name ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
clustering : chimera interactions with the same ligated microRNA and overlapping genomic coordinates were clustered; Genome_Intervals R package; ;
Genome_build: mm9
Supplementary_files_format_and_content: Excel spreadsheet with gene coordinate information and additional annotations for chimera-identified interactions
Supplementary_files_format_and_content: Excel spreadsheet gene coordinate information for standard CLIP AGO binding peaks, and overlapping microRNA seed matches and chimera interactions
 
Submission date Sep 15, 2015
Last update date May 15, 2019
Contact name Michael John Moore
Organization name The Rockefeller University
Department Molecular Neuro-Oncology
Lab Robert Darnell
Street address 1230 York Ave Box 226
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL16417
Series (2)
GSE73058 miRNA-target chimeras identified with CLEAR-CLIP reveal miRNA 3' end pairing as a major determinant of Argonaute binding in vivo [mouse cortex CLEAR-CLIP]
GSE73059 miRNA-target chimeras identified with CLEAR-CLIP reveal miRNA 3' end pairing as a major determinant of Argonaute binding in vivo
Relations
BioSample SAMN04088124
SRA SRX1247162

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap