 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 17, 2015 |
| Title |
UWOPS_2 |
| Sample type |
SRA |
| |
|
| Source name |
meiotic culture
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: UWOPS03-461.5
epitope tag: epitope tag: Spo11-Flag
meiotic time-point: 6 hr in meiosis
|
| Growth protocol |
Cells were grown in YPA (1% yeast extract, 2% Bacto Peptone, 1% potassium acetate) for 14 hr at 23°C, harvested, resuspended to OD600=6.0 in 1% potassium acetate, 0.2 × supplements (2 μg/mL adenine, 2 μg/mL histidine, 6 μg/mL leucine, 2 μg/mL tryptophan, 2 μg/mL uracil) and sporulated at 23°C.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Based on Pan et al. 2011 Cell 144:719-731. Whole cell extracts were prepared by grinding frozen cells in a bead mill and resuspending powder in 10%TCA. Pellets were then extracted with SDS and soluble protein was subjected to affinity purification of Spo11-Flag fusion with Protein-G Dynabeads. Protein was digested with proteinase K and Spo11-associated oligonucleotides were recovered by ethanol precipitation.
Based on Pan et al. 2011 Cell 144:719-731. Oligonucleotides were tailed with ribo-G using rGTP and terminal transferase, then ligated to duplex DNA adaptors with a dC overhang using T4 RNA ligase 2. Complementary strands were synthesized with Klenow, then purified by denaturing polyacrylamide electrophoresis. Purified complementary strands were subjected to 3' tailing with ribo-G using rGTP and terminal transferase, then another duplex adaptor was ligated using T4 RNA ligase 2. Ligated material was amplified with 16 cycles of PCR to add Illumina HiSeq adaptors
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Spo11-associated DNA oligonucleotides
|
| Data processing |
Base calls perfomed using HiSeq Control Software v.2.0.10.0 for samples sequenced on Illumina HiSeq 2500
Adapters (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) were clipped from reads using fastx_clipper, part of the FASTX Toolkit 0.0.13.2, with parameters -l 15 -n -v -Q33 -i
First five bases (diffusion primer added in library prep) in each sequence were trimmed and trimmed sequence was recorded in the FASTQ ID tag for downstream tracking
Clipped reads were mapped using SHRiMP 2.1.1b with parameters -N 15 -U -g -1000 -q -1000 -m 10 -i -20 -h 100 -r 50% -n 1 -s 1111111111,11110111101111,1111011100100001111,1111000011001101111 -o 1001 -Q -E --sam-unaligned --strata
Sequences clipped from a read during mapping should be polyC on the 3' end or polyG on the 5' end. If clipped bases were not polyC or polyG the alignment score was corrected by deducting the mismatch score for each non-C,G base in the clipped sequence.
Maps of 5' ends of sequence reads were compiled and analyzed in R (RStudio version 0.98.1091, R version 3.0.1)
Genome_build: For wild-derived S. cerevisiae strains YPS128 and UWOPS03-461.4, reads were mapped to the SGD assembly released in June 2008, called "sacCer2" by UCSC: http://genome.ucsc.edu/cgi-bin/hgGateway?hgsid=340067645; for S. paradoxus YPS138, reads were mapped to the strain's genome assembly from SGRP (Saccharomyces Genome Resequencing Project, Wellcome Trust Sanger Institute); for S. mikatae IFO1815 and S. kudriavzevii ZP591, reads were mapped to the strains' genome assemblies from Scannell et al. 2011 G3 1: 11-25, available on http://www.saccharomycessensustricto.org.
Supplementary_files_format_and_content: wig files include RPM (reads per million mapped) for each sample at each non-zero base position in the genome
|
| |
|
| Submission date |
Aug 10, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Isabel Lam |
| Organization name |
Memorial Sloan Kettering Cancer Center
|
| Department |
Molecular Biology
|
| Lab |
Keeney Lab
|
| Street address |
1275 York Avenue
|
| City |
New York |
| State/province |
New York |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL17342 |
| Series (2) |
| GSE71887 |
Spo11-oligo mapping in Saccharomyces species (S. paradoxus, S. mikatae, S. kudriavzevii) and wild-derived S. cerevisiae strains (YPS128, UWOPS03-461.4) |
| GSE71930 |
Non-paradoxical evolutionary stability of the recombination initiation landscape in Saccharomycetes |
|
| Relations |
| BioSample |
SAMN03979987 |
| SRA |
SRX1141309 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1847201_20150526_UWOPS-2_normalized_hitmap.wig.gz |
2.3 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
