NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1682607 Query DataSets for GSM1682607
Status Public on Apr 04, 2016
Title n18_9_4C
Sample type SRA
 
Source name liver_CT18
Organism Mus musculus
Characteristics tissue: liver
strain: C57BL/6
age: six weeks
circadian time: CT18
gender: male
Extracted molecule genomic DNA
Extraction protocol C57BL/6 male Mice of six weeks old were entrained to 12 hr light and 12 hr dark for one week and then switched to constant dark. Three mice were sacrificed in the dark at ZT6 and ZT18, respectively. Mice liver cells were quickly dispersed and filtered through the 40 mm cell strainer to make a single-cell suspension. Approximately 50-million cells were fixed in 1% formaldehyde for 10 min at room temperature before being quenched with 0.125 M glycine. Cells were then lysed in cold lysis buffer (10 mM Tris HCl, 10 mM NaCl, 0.2% NP-40, 1×protease inhibitor) for 15 min on ice. After being washed twice, nuclei were re-suspended in Buffer 2.1 (New England Biolabs), including 0.1% SDS, and were incubated for 10 min at 65°C. 1% (final concentration) Triton X-100 was added to quench SDS and centrifuged to remove SDS and Triton. Nuclei were then digested overnight by 800U Hind III (NEB) at 37℃ with shaking. After inactivation by 1.6% (final concentration) SDS at 65℃ for 20 min, samples were washed and re-suspended in ligation buffer, and ligated by 100U T4 DNA ligase (Thermo Fisher Scientific) at 16℃ for 4 h and then room temperature for 30 min. Ligated chromatin was digested by proteinase K before DNA purification. The purified DNA was further digested by Dpn II (NEB) and then circularized using T4 DNA ligase (Thermo Fisher Scientific).
After purification, 200ng of DNA from each sample was used as template for the PCR amplification using the DyNAzyme EXT (Finnzymes). Primers specific to bait were applied to amplify the interactome of interest in a 25ul reaction volume under the following PCR conditions: 1 cycle at 94°C for 2 min; (94°C 30 sec; 60°C 30 min; 72°C 2 min) ×18 cycles; 1 cycle of 72°C 7 min. 1uL of PCR products was used as template for a second PCR reaction utilizing the primers with the addition of the Illumina adaptors in a 50ul volume under the same PCR conditions. The PCR-amplified library was purified and sequenced with a 100bp read length using the Illumina HiSeq2000.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Data processing Library strategy: 4C-seq
FASTQ reads of 4C-seq were demultiplexed using the bait primers (HindIII primer: CAGGCATGAGCAACGCAGA; DpnII primer: AGAAGAGGGTAAGCAGCAAAGGT), that is, removing the upstream of HindIII restriction site (AAGCTT) and the downstream of of DpnII restriction site (GATC).
The reads were aligned to mouse genome mm9 by Bowtie0.12 (-v 3 -m 1). Only reads uniquely mapped to the HindIII restriction sites on the cis-chromosome of the bait were kept and assigned the HindIII restricted fragments defined by two neighboring restriction sites.
Peak calling was performed as previously described (Tolhuis et al., 2011). Briefly, HindIII restricted fragments with more than one reads were smoothed by applying a running median with window size of 10 fragments. The background of read distribution along the chromosome was obtained by LOESS (local polynomial regression) on the smoothed and logarithm-transformed reads numbers. The HindIII restricted fragments bearing more reads than background were selected as candidate fragments. Continuous candidate fragments were merged into a single region. For each time point, we required interacting regions were called in at least two duplicates.
Genome_build: mm9
Supplementary_files_format_and_content: Tab-separated plain file for reads count of HindIII restricted fragment on cis-chromosome (chr11). The 1st-3rd columns indicate the position of HindIII restricted fragment, which is defined by two neighboring HindIII restriction sites. The 4th column is the count of reads mapping to the fragment.
 
Submission date May 13, 2015
Last update date May 15, 2019
Contact name Yichi Xu
E-mail(s) xuy2@mskcc.org
Organization name MSKCC
Street address 1275 York Avenue
City New York
State/province NY
ZIP/Postal code 10065
Country USA
 
Platform ID GPL13112
Series (2)
GSE68830 Long-range chromosome interactions mediated by cohesin shape circadian gene expression [4C]
GSE68832 Long-range chromosome interactions mediated by cohesin shape circadian gene expression
Relations
BioSample SAMN03656264
SRA SRX1024681

Supplementary file Size Download File type/resource
GSM1682607_n9_count.txt.gz 257.8 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap