 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 04, 2016 |
| Title |
n6_8_4C |
| Sample type |
SRA |
| |
|
| Source name |
liver_CT6
|
| Organism |
Mus musculus |
| Characteristics |
tissue: liver
strain: C57BL/6
age: six weeks
circadian time: CT6
gender: male
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
C57BL/6 male Mice of six weeks old were entrained to 12 hr light and 12 hr dark for one week and then switched to constant dark. Three mice were sacrificed in the dark at ZT6 and ZT18, respectively. Mice liver cells were quickly dispersed and filtered through the 40 mm cell strainer to make a single-cell suspension. Approximately 50-million cells were fixed in 1% formaldehyde for 10 min at room temperature before being quenched with 0.125 M glycine. Cells were then lysed in cold lysis buffer (10 mM Tris HCl, 10 mM NaCl, 0.2% NP-40, 1×protease inhibitor) for 15 min on ice. After being washed twice, nuclei were re-suspended in Buffer 2.1 (New England Biolabs), including 0.1% SDS, and were incubated for 10 min at 65°C. 1% (final concentration) Triton X-100 was added to quench SDS and centrifuged to remove SDS and Triton. Nuclei were then digested overnight by 800U Hind III (NEB) at 37℃ with shaking. After inactivation by 1.6% (final concentration) SDS at 65℃ for 20 min, samples were washed and re-suspended in ligation buffer, and ligated by 100U T4 DNA ligase (Thermo Fisher Scientific) at 16℃ for 4 h and then room temperature for 30 min. Ligated chromatin was digested by proteinase K before DNA purification. The purified DNA was further digested by Dpn II (NEB) and then circularized using T4 DNA ligase (Thermo Fisher Scientific).
After purification, 200ng of DNA from each sample was used as template for the PCR amplification using the DyNAzyme EXT (Finnzymes). Primers specific to bait were applied to amplify the interactome of interest in a 25ul reaction volume under the following PCR conditions: 1 cycle at 94°C for 2 min; (94°C 30 sec; 60°C 30 min; 72°C 2 min) ×18 cycles; 1 cycle of 72°C 7 min. 1uL of PCR products was used as template for a second PCR reaction utilizing the primers with the addition of the Illumina adaptors in a 50ul volume under the same PCR conditions. The PCR-amplified library was purified and sequenced with a 100bp read length using the Illumina HiSeq2000.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Library strategy: 4C-seq
FASTQ reads of 4C-seq were demultiplexed using the bait primers (HindIII primer: CAGGCATGAGCAACGCAGA; DpnII primer: AGAAGAGGGTAAGCAGCAAAGGT), that is, removing the upstream of HindIII restriction site (AAGCTT) and the downstream of of DpnII restriction site (GATC).
The reads were aligned to mouse genome mm9 by Bowtie0.12 (-v 3 -m 1). Only reads uniquely mapped to the HindIII restriction sites on the cis-chromosome of the bait were kept and assigned the HindIII restricted fragments defined by two neighboring restriction sites.
Peak calling was performed as previously described (Tolhuis et al., 2011). Briefly, HindIII restricted fragments with more than one reads were smoothed by applying a running median with window size of 10 fragments. The background of read distribution along the chromosome was obtained by LOESS (local polynomial regression) on the smoothed and logarithm-transformed reads numbers. The HindIII restricted fragments bearing more reads than background were selected as candidate fragments. Continuous candidate fragments were merged into a single region. For each time point, we required interacting regions were called in at least two duplicates.
Genome_build: mm9
Supplementary_files_format_and_content: Tab-separated plain file for reads count of HindIII restricted fragment on cis-chromosome (chr11). The 1st-3rd columns indicate the position of HindIII restricted fragment, which is defined by two neighboring HindIII restriction sites. The 4th column is the count of reads mapping to the fragment.
|
| |
|
| Submission date |
May 13, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Yichi Xu |
| E-mail(s) |
xuy2@mskcc.org
|
| Organization name |
MSKCC
|
| Street address |
1275 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (2) |
| GSE68830 |
Long-range chromosome interactions mediated by cohesin shape circadian gene expression [4C] |
| GSE68832 |
Long-range chromosome interactions mediated by cohesin shape circadian gene expression |
|
| Relations |
| BioSample |
SAMN03656205 |
| SRA |
SRX1024680 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1682606_n8_count.txt.gz |
255.4 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
