NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1660950 Query DataSets for GSM1660950
Status Public on Jul 01, 2015
Title lympho-directExtract
Sample type SRA
 
Source name Lymphocytes
Organism Homo sapiens
Characteristics sample type: No ribosome purification
cell type: Lymphocytes
Treatment protocol -
Growth protocol RPMI + 15% FBS, 37C, 5% CO2
Extracted molecule total RNA
Extraction protocol Cells lysed in 200 mM KOAC, 15 mM MgCl, 15 mM K-HEPES pH 7.2, 180 uM cycloheximide. Treated with 10 ug/ml Mnase for 30 min
NEB Directional Small RNA kit. Libraries purified by gel electrophoresis
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2500
 
Data processing Cutadapt
Trim AAGATCGGAAGAGCACACGTCT
cutadapt -a AAGATCGGAAGAGCACACGTCT --discard-untrimmed -m 20 DBA37-P.fastq -o trimDBA37-P.fastq
cutadapt 1.6 with Python 2.7.6
Bowtie
bowtie -p 7 -v 0 --norc database/chosenTranscripts reads/trimDBA37-P.fastq mapped/DBA37-P.map
Bowtie 1.1.1
Genome_build: NCBI v37
Supplementary_files_format_and_content: XLSX; RPKM values for all genes within the coding sequence
 
Submission date Apr 17, 2015
Last update date May 15, 2019
Contact name David Reid
Organization name Duke University
Department Biochemistry
Lab Nicchitta
Street address 436 Nanaline Duke Bldg., Box 3709 DUMC
City Durham
State/province NC
ZIP/Postal code 27710
Country USA
 
Platform ID GPL16791
Series (1)
GSE68008 Methods comparison for ribosome profiling
Relations
BioSample SAMN03490542
SRA SRX998837

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap