GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
Sample GSM1604258 Query DataSets for GSM1604258
Status Public on Apr 20, 2015
Title pKO-H3K4me3_D0
Sample type SRA
Source name Haunt pKO mES cells
Organism Mus musculus
Characteristics sample type: Haunt knock out in 46C cells
treatment: none
strain: 129/Ola
chirp probes: none
genotype: Haunt pKO
cell line: 46C
cell type: embryonic stem cells
chip antibody: H3K4me3 (Abcam, ab8580)
barcode: TGCTGAT
Treatment protocol Cells were washed once with cold PBS, then harvested by trypsin digestion.
Growth protocol Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).
Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).
Extracted molecule genomic DNA
Extraction protocol ChIP was done following previously protocol (Shen, 2008). Briefly, cell were crosslinked on plate with 0.9% FMA for 10 min, then quenched by 1/20 volume of 2.5 M glycine. after two times of ice cold PBS wash, cell were harvested by trypsin digestion, and lysis by 1 x nuclei lysis buffer. Then Sonicated into average size 200-500 bp. 14000rpm for 15 min, supernatant were diluted by ChIP dilution buffer. 3 ug H3K4me3 (Abcam, ab8580) or H3K27me3 antibodies (Millipore, #07-449) were added, 4℃, end to end rotate overnight. 30 ul Protein AG UltraLink Resin (Thermo, 53133) were added, 4℃, end to end rotate for 3 times. after thoroughly wash, the DNA were eluted by elution buffer with protease K at 65℃.
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrieved DNA was end repaired, and dA-tailed by respect module according to respect instruments. The DNA product then ligated with adaptor with NEBNext Quick Ligation Module. The adaptor for the libary were sythersized from IDT with the first 7nt is "TGCTGAT" as a barcode. After liagation, the DNA were amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Genome Analyzer following the manufacturer's protocols.
Total RNA of RNA-Seq were extracted by TRIzol reagent according to manufacturer's instruction. mRNA were further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instruction.
Libraries were prepared by illumina TruSeq Stranded mRNA LT Sample Prep Kit (RS-122-2101) according to the standard protocols of the manufacturer. ChIRP retrieved DNA-seq were prepared by library preparation modules (New England Biolabs) according to manufacturer's instructions.
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model Illumina HiSeq 2500
Data processing Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for wild-type or Haunt KO Samples, bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
Submission date Feb 09, 2015
Last update date May 15, 2019
Contact name jinlong lu
Phone 5853098469
Organization name University of Rochester
Lab Gorbunova & Seluanov Labs
Street address 213 Hutchinson Hall
City Rochester
State/province NY
ZIP/Postal code 14627
Country USA
Platform ID GPL17021
Series (1)
GSE58514 Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation
BioSample SAMN03333449
SRA SRX869305

Supplementary file Size Download File type/resource
GSM1604258_histone_B2.bigWig 40.0 Mb (ftp)(http) BIGWIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap