NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1557103 Query DataSets for GSM1557103
Status Public on Sep 08, 2015
Title HPAF-1 24h JQ1 200 nM
Sample type SRA
 
Source name Cell line
Organism Homo sapiens
Characteristics treatment: 24h JQ1 200 nM
diagnosis: PDAC
Extracted molecule total RNA
Extraction protocol Cells were harvested, flash frozen on dry ice, and RNA was extracted using RLT plus buffer (Qiagen) reagent.
RNA libraries were prepared for sequencing using standard Illumina protocols
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 1500
 
Description Sample 70
processed_data file: human_JQ1_timeseries_counts.tsv
processed_data file: human_JQ1_timeseries_RPKMs.tsv
Data processing The paired-end and single-read fragments were trimmed on their 5' end (6 cycles PE100, 2 cycles SR50 NEB RNA sample prep protocol)
Adaptors were removed using cutadapt v1.4.2 and reads with a length of less than 18bp in any read of the pair were discarded. (Read1: cutadapt --match-read-wildcards -O 4 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, Read2: cutadapt --match-read-wildcards -O 4 -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT)
The trimmed and adaptor free reads were aligned against rDNA of the respective organism using bowtie2 v2.0.2 for paired-end and bowtie v0.12.5 for single-end reads. (100PE: bowtie2 (v2.0.2) --sensitive-local, 50SR: bowtie v0.12.5 -v 3 -k 1 --tryhard --chunkmbs 256)
The rRNA cleaned paired-end reads were aligned against the transcriptome to estimate the fragment size and the standard deviation of the fragment size using bwa v0.6.2. ( -N 1 -n 1 -a 1000)
The rRNA cleaned reads were aligned to the genome with the TopHat splice junction mapper for RNA-Seq reads using splice junction guidance of a GTF annotation file (mouse: mm10, RefSeq from UCSC, 2012/5/23, human: hg19, RefSeq 2012/11/30) (--segment-mismatches 1 --max-multihits 20 --library-type fr-firststrand --initial-read-mismatches 2, 100PE: --segment-length 25 --mate-inner-dist value from transcriptome alignment --mate-std-dev value from transcriptome alignment; SR50: --segment-length 24)
The uniquely aligning reads were used for counting per gene with htseq-count v 0.6.1p with the overlap-resolution mode option set to 'union' using the processed RefSeq-annotated gene database (supplementary files refseq.hg19.2014_0110.imp.merged.uniq.exons.fulltable.gtf and refseq.mm10.2014_3006.imp.merged.uniq.exons.fulltable.gtf)
genome build: hg19 / mm10
processed data files format and content: Tab-delimited text files containing raw counts and RPKMs for given samples
 
Submission date Dec 02, 2014
Last update date May 15, 2019
Contact name Philipp Rathert
E-mail(s) philipp.rathert@ibtb.uni-stuttgart.de
Organization name University Stuttgart
Department Biochemistry
Street address Allmandring 31
City Stuttgart
State/province Germany
ZIP/Postal code 70569
Country Germany
 
Platform ID GPL18460
Series (1)
GSE63782 Transcriptional plasticity promotes primary and acquired resistance to BET bromodomain inhibition
Relations
BioSample SAMN03248162
SRA SRX793242

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap