NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1533289 Query DataSets for GSM1533289
Status Public on Jul 16, 2015
Title 20dd_DOX_plus_TRA_minus_Rep1_smallRNA
Sample type SRA
 
Source name reprogramming intermediates of hiF-T cells
Organism Homo sapiens
Characteristics surface antigen enrichment: TRA-1-60-
treatment: DOX days 0-20
Treatment protocol Reprogramming treatments were perfomed by doxycyclin administration to hiF-T cells in hiF media first and hES media (basal medium, 20% KSR, 8ng/ml) after. Reprogramming intermediates were collected by MEF depletion and eventual surface marker enrichment as needed. Refer to manuscript for detailed reprogramming and sampling procedures.
Growth protocol Refer to the section Cell Culture and Reprogramming in the Supplemental Experimental Procedures of the related manuscript.
Extracted molecule total RNA
Extraction protocol Total RNA, including the small RNA fraction, was obtained by organic extraction followed by miRNeasy purification (Qiagen).
RNA-Seq Illumina libraries for small RNA profiling were prepared from 1 ug of total RNA using the TruSeq Small RNA Sample Prep Kit (Illumina).
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Description Second reprogramming
Data processing Small RNA read were mapped to the human genome with TopHat 2.0.7 and Bowtie 2.1.0. Spliced alignment by TopHat was disabled by omitting the GENCODE annotation file and providing the -no-novel-juncs option, which forces all alignments to be unspliced. Sequencing adapters were clipped from the reads using fastx_clipper form the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/), using the options "-a TGGAATTCTCGGGTGCCAATGAACTCCAG -l 18 -Q 33". Reads were mapped with TopHat, as opposed to Bowtie, because the resulting alignment files are properly formatted for direct input to Cuffdiff. Small RNA expression levels were estimated using Cuffdiff 2.2.0 by providing Cuffdiff with the small RNA records from the GENCODE annotation. The number of reads generated from each small RNA is directly proportional to abundance, and independent of small RNA length, so the option -no-length-correction was provided to Cuffdiff, disabling length-based normalization of read counts.
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text files include normalized counts for each sample
 
Submission date Oct 28, 2014
Last update date May 15, 2019
Contact name Shannan J Ho Sui
E-mail(s) shosui@hsph.harvard.edu
Organization name Harvard T.H. han Scholol of Public Health
Department Biostatistics
Street address 655 Huntington Ave, Building 2, Rm 437A
City Boston
State/province Massachusetts
ZIP/Postal code 02115
Country USA
 
Platform ID GPL16791
Series (2)
GSE62776 Integrative analyses of human reprogramming reveal dynamic nature of induced pluripotency [small RNA-Seq]
GSE62777 Integrative analyses of human reprogramming reveal dynamic nature of induced pluripotency
Relations
BioSample SAMN03145566
SRA SRX745276

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap