NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1467492 Query DataSets for GSM1467492
Status Public on Aug 08, 2014
Title PNFF-hMPN1 U6
Sample type SRA
 
Source name human PN patient cells, compensated with hMPN1
Organism Homo sapiens
Characteristics subject status: poikiloderma with neutropenia (PN) patient
cell type: foreskin fibroblasts from PN patient (PNFF)
genotype/variation: PNFF-hMPN1; compensated with hMPN1
Growth protocol PNFF-derived cells were maintained in DMEM supplemented with 20% fetal bovine serum, non-essential amino acids, penicillin/streptomycin
Extracted molecule total RNA
Extraction protocol Trizol reagent was used to isolate total RNA from human cells.
PNK treated total RNA was purified with the RNA clean and concentrator kit (Zymo Research). 120 pmol of 5’ phosphorylated 3’ RACE adapter oligonucleotide (cctatagtgagtcgtattaattctgtgctcgc(tdd)) were mixed with 3 µg of purified RNA and ligated with T4 RNA ligase as above. 1 µg of ligated RNA was reverse-transcribed with Superscript III (Invitrogen) using adapter-specific oligonucleotide (GCGAGCACAGAATTAATACGACT). cDNA was PCR-amplified with the Phusion High-Fidelity PCR kit (Thermo Scientific) and PCR products were sequenced. Primers to amplify human U6 (acactctttccctacacgacgctcttccgatctcggcagcacatatactaaaattggaac + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify U6atac (acactctttccctacacgacgctcttccgatcttgttgtatgaaaggagagaaggttagcactc + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify vtRNA1-1 (acactctttccctacacgacgctcttccgatctgctggctttagctcagcggttacttcg + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection RACE
Instrument model Illumina HiSeq 2500
 
Description PCR product corresponding to human U6 snRNA was sequenced.
GQY44
Data processing Basecalls performed using CASAVA version 1.8.2
Adapter sequences were removed using cutadapt
Reads were aligned to the indicated reference sequence using BLAT version 35x1. If applicable, read pairs where any of the reads matched the intron were removed.
Read pairs corresponding to full-length species were retained, and the terminal nucleotide sequence was extracted. The frequency of each terminal nucleotide sequence in the sample was computed.
Supplementary_files_format_and_content: txt files containing the frequency of each terminal nucleotide sequence
 
Submission date Aug 07, 2014
Last update date May 15, 2019
Contact name Claus M Azzalin
E-mail(s) claus.azzalin@bc.biol.ethz.ch
Organization name ETH Zürich
Department Institute of Biochemistry
Street address Otto-Stern-Weg 3
City Zürich
ZIP/Postal code 8093
Country Switzerland
 
Platform ID GPL16791
Series (2)
GSE60196 human 3' RACE
GSE60198 The Mpn1 exonuclease defines a novel spliceosomal snRNA decay pathway dependent on Rrp6 and Lsm2-8 complex
Relations
BioSample SAMN02954383
SRA SRX671720

Supplementary file Size Download File type/resource
GSM1467492_GQY44_endings_final_all_count.txt.gz 7.4 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap