|
| Status |
Public on Aug 08, 2014 |
| Title |
PNFF-hMPN1 U6atac |
| Sample type |
SRA |
| |
|
| Source name |
human PN patient cells, compensated with hMPN1
|
| Organism |
Homo sapiens |
| Characteristics |
subject status: poikiloderma with neutropenia (PN) patient
cell type: foreskin fibroblasts from PN patient (PNFF)
genotype/variation: PNFF-hMPN1; compensated with hMPN1
|
| Growth protocol |
PNFF-derived cells were maintained in DMEM supplemented with 20% fetal bovine serum, non-essential amino acids, penicillin/streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Trizol reagent was used to isolate total RNA from human cells.
PNK treated total RNA was purified with the RNA clean and concentrator kit (Zymo Research). 120 pmol of 5’ phosphorylated 3’ RACE adapter oligonucleotide (cctatagtgagtcgtattaattctgtgctcgc(tdd)) were mixed with 3 µg of purified RNA and ligated with T4 RNA ligase as above. 1 µg of ligated RNA was reverse-transcribed with Superscript III (Invitrogen) using adapter-specific oligonucleotide (GCGAGCACAGAATTAATACGACT). cDNA was PCR-amplified with the Phusion High-Fidelity PCR kit (Thermo Scientific) and PCR products were sequenced. Primers to amplify human U6 (acactctttccctacacgacgctcttccgatctcggcagcacatatactaaaattggaac + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify U6atac (acactctttccctacacgacgctcttccgatcttgttgtatgaaaggagagaaggttagcactc + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify vtRNA1-1 (acactctttccctacacgacgctcttccgatctgctggctttagctcagcggttacttcg + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
RACE |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
PCR product corresponding to human U6atac snRNA was sequenced.
GQY42
|
| Data processing |
Basecalls performed using CASAVA version 1.8.2
Adapter sequences were removed using cutadapt
Reads were aligned to the indicated reference sequence using BLAT version 35x1. If applicable, read pairs where any of the reads matched the intron were removed.
Read pairs corresponding to full-length species were retained, and the terminal nucleotide sequence was extracted. The frequency of each terminal nucleotide sequence in the sample was computed.
Supplementary_files_format_and_content: txt files containing the frequency of each terminal nucleotide sequence
|
| |
|
| Submission date |
Aug 07, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Claus M Azzalin |
| E-mail(s) |
claus.azzalin@bc.biol.ethz.ch
|
| Organization name |
ETH Zürich
|
| Department |
Institute of Biochemistry
|
| Street address |
Otto-Stern-Weg 3
|
| City |
Zürich |
| ZIP/Postal code |
8093 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE60196 |
human 3' RACE |
| GSE60198 |
The Mpn1 exonuclease defines a novel spliceosomal snRNA decay pathway dependent on Rrp6 and Lsm2-8 complex |
|
| Relations |
| BioSample |
SAMN02954381 |
| SRA |
SRX671718 |
