NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1467481 Query DataSets for GSM1467481
Status Public on Aug 08, 2014
Title cid14Δmpn1Δ
Sample type SRA
 
Source name fission yeast
Organism Schizosaccharomyces pombe
Characteristics strain: CAF383
genotype/variation: cid14Δmpn1Δ
Growth protocol Logarithmically growing yeast cells in liquid YES media at 30°C, shaking at 150 rpm
Extracted molecule total RNA
Extraction protocol Hot phenol RNA dextraction protocol (Schmitt ME, Brown TA & Trumpower BL (1990) A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18: 3091–3092)
PNK treated total RNA was purified with the RNA clean and concentrator kit (Zymo Research). 120 pmol of 5’ phosphorylated 3’ RACE adapter oligonucleotide (cctatagtgagtcgtattaattctgtgctcgc(tdd)) were mixed with 3 µg of purified RNA and ligated with T4 RNA ligase as above. 1 µg of ligated RNA was reverse-transcribed with Superscript III (Invitrogen) using adapter-specific oligonucleotide (GCGAGCACAGAATTAATACGACT). cDNA was PCR-amplified with the Phusion High-Fidelity PCR kit (Thermo Scientific) and PCR products were sequenced. Primers to amlify U6 snRNA (acactctttccctacacgacgctcttccgatctgatcttcggatcactttggt + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg); Primers to amplify tagged U6 (acactctttccctacacgacgctcttccgatctgatcttcggatcactttgatcttcg + ctcggcattcctgctgaaccgctcttccgatctcgcggatccgaattaatacgactcactatagg)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection RACE
Instrument model Illumina HiSeq 2000
 
Description GQY31
PCR product corresponding to U6 snRNA was sequenced.
Data processing Basecalls performed using CASAVA version 1.8.2
Adapter sequences were removed using cutadapt
Reads were aligned to the indicated reference sequence using BLAT version 35x1. If applicable, read pairs where any of the reads matches the intron were removed.
Read pairs corresponding to full-length species were retained, and the terminal nucleotide sequence was extracted. The frequency of each terminal nucleotide sequence in the sample was computed.
Supplementary_files_format_and_content: txt files containing the frequency of each terminal nucleotide sequence
 
Submission date Aug 07, 2014
Last update date May 15, 2019
Contact name Claus M Azzalin
E-mail(s) claus.azzalin@bc.biol.ethz.ch
Organization name ETH Zürich
Department Institute of Biochemistry
Street address Otto-Stern-Weg 3
City Zürich
ZIP/Postal code 8093
Country Switzerland
 
Platform ID GPL13988
Series (2)
GSE60195 yeast U6 3' RACE
GSE60198 The Mpn1 exonuclease defines a novel spliceosomal snRNA decay pathway dependent on Rrp6 and Lsm2-8 complex
Relations
BioSample SAMN02954372
SRA SRX671709

Supplementary file Size Download File type/resource
GSM1467481_GQY31_endings_final_all_count.txt.gz 13.4 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap