NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1412848 Query DataSets for GSM1412848
Status Public on Apr 20, 2015
Title KO_DNA
Sample type SRA
 
Source name Haunt P-exon2 KO mES cells
Organism Mus musculus
Characteristics cell line: 46C
cell type: embryonic stem cells
genotype/variation: Haunt P-exon2 KO
treatment: none
strain: 129/Ola
chirp probes: ChIRP probes targeting Haunt mRNA
Treatment protocol Cells were washed once with cold PBS, then harvested by trypsin digestion.
Growth protocol Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).
Extracted molecule genomic DNA
Extraction protocol ChIRP was done as described previously with the following modifications (Chu et al. 2011). First, 59 nt DNA probes were biotinylated through terminal transferase (New England Biolabs). Intensive crosslinking of cells was performed in the following sequence: two rounds of 3000J UV treatment on ice, 0.8% of formaldehyde (FMA) for 10 minutes, 2mM of DSP (Dithiobis [succinimidyl propionate]) for 30 minutes, and followed by 3.7% of FMA for 10 minutes at room temperature. Crosslinked cell pellets were lysed. Chromatin was fragmented into a range of 2 - 5 kb by sonication. Hybridization, washing and elution steps were performed as described previously, except that we included an additional stringent wash (0.1x SSC). After elution and reverse crosslinking, then purified by MinElute PCR Purification Kit (QIAGEN).
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, ChIRP retrieved DNA was end repaired, and dA-tailed by respect module according to respect instruments. The DNA product then ligated with adaptor with NEBNext Quick Ligation Module. The adaptor for the libary were sythersized from IDT with the first 7nt is "CAGATGT" as a barcode. After liagation, the DNA were amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Illumina instrument following the manufacturer's protocols.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina HiSeq 2500
 
Description Sample 23
barcode: CAGATGT
Sample 23
Data processing library strategy: ChIRP-seq
The sequencing company provided "clean reads" (i.e., low quality reads removed).
Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: RNA-seq: tab-delimited text files include FPKM values for wild-type or Haunt KO Samples; ChIRP-seq: bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
 
Submission date Jun 16, 2014
Last update date May 15, 2019
Contact name jinlong lu
E-mail(s) bioyuyang@hotmail.com
Phone 5853098469
Organization name University of Rochester
Lab Gorbunova & Seluanov Labs
Street address 213 Hutchinson Hall
City Rochester
State/province NY
ZIP/Postal code 14627
Country USA
 
Platform ID GPL17021
Series (1)
GSE58514 Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation
Relations
BioSample SAMN02863127
SRA SRX644391

Supplementary file Size Download File type/resource
GSM1412848_DNAKO.bedgraph.gz 4.2 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap