NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1412841 Query DataSets for GSM1412841
Status Public on Apr 20, 2015
Title KO-j_D2(RA)
Sample type SRA
 
Source name Haunt 58 kb KO mES cells (RA, Day2)
Organism Mus musculus
Characteristics cell line: 46C
cell type: embryonic stem cells
genotype/variation: Haunt 58 kb KO
treatment: LIF withdrawal, 2uM RA-induced differentiation
time: day2
strain: 129/Ola
Growth protocol ESCs were cultured in N2B27 complete "2i" medium including: 100 ml DMEM/F12 basal medium (Life Technologies), 100 ml Neurobasal medium (Life Technologies), 1 ml N2 supplement (Life Technologies), 2 ml B27 supplement (Life Technologies), 1 ml 100 × Glutamax (Life Technologies) and 0.1 mM 2-mercaptoethanol, 1000U/ml recombinant leukemia inhibitory factor (LIF, millipore) and "2i" (1 uM PD03259010, 3 uM CHIR99021) for one day. The cells were then passaged with N2B27 medium without LIF or "2i", and supplemented with 2 uM retinoic acid (RA), change medium everyday. Cells were harvested at day 2 of RA-induced differentiation
Extracted molecule total RNA
Extraction protocol Cells were harvested at day 2 of RA-induced differentiation. TRIzol reagent was added directly into the plate after cold 1 × PBS wash once. The total RNA was extracted according to manufacturer's instructions. mRNA was further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instructions.
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, mRNA was fragmentated by NEBNext Magnesium RNA Fragmentation Module at 94 ℃ for 5 min. The fragementated RNA was reverse transcribed by SuperScript III First-Strand Synthesis System for RT-PCR kit (Life Technology), 2'nd strand was then synthesized by NEBNext mRNA Second Strand Synthesis Module , the end repair, dA-tailing and adaptor ligation were also following the instruments by respect module. the adaptor for the libary was sythersized from IDT with the first 7nt is "CAGATGT" as a barcode. After liagation, the DNA was amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 15 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Illumina instrument following the manufacturer's protocols.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 1500
 
Description Sample 16
messenger RNA
processed data file: mRNA profiling_Haunt 58 kb KO_RA differentiation.txt
barcode: CAGATGT
Sample 16
Data processing The sequencing company provided "clean reads" (i.e., low quality reads removed).
Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: RNA-seq: tab-delimited text files include FPKM values for wild-type or Haunt KO Samples; ChIRP-seq: bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.
 
Submission date Jun 16, 2014
Last update date May 15, 2019
Contact name jinlong lu
E-mail(s) bioyuyang@hotmail.com
Phone 5853098469
Organization name University of Rochester
Lab Gorbunova & Seluanov Labs
Street address 213 Hutchinson Hall
City Rochester
State/province NY
ZIP/Postal code 14627
Country USA
 
Platform ID GPL18480
Series (1)
GSE58514 Opposing roles for the lncRNA Haunt and its genomic locus in regulating HOXA gene activation during embryonic stem cell differentiation
Relations
BioSample SAMN02863134
SRA SRX644384

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap