 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 31, 2015 |
| Title |
L3524_MUT219_WK8 |
| Sample type |
SRA |
| |
|
| Source name |
mutant_week8
|
| Organism |
Mus musculus |
| Characteristics |
age: 8 weeks
genotype/variation: Aldh1b1tm1lacz; Aldh1b1 null
tissue: islets
|
| Treatment protocol |
Maintained for two hours in RPMI-1640 supplemented with 10% FBS
|
| Growth protocol |
Islets isolated from fresh pancreata
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was prepared using the RNeasy kit (Qiagen) with on-column genomic DNA digestion.
mRNA was isolated from 1ug total RNA by poly-dT enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module according to the manufacturers instructions. Final elution was done in 15ul 2x first strand cDNA synthesis buffer (NEBnext, NEB). After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (Ultra Directional RNA Library Prep, NEB). For ligation custom adaptors were used (Adaptor-Oligo 1: 5'-ACA-CTC-TTT-CCC-TAC-ACG-ACG-CTC-TTC-CGA-TCT-3', Adaptor-Oligo 2: 5'-P-GAT-CGG-AAG-AGC-ACA-CGT-CTG-AAC-TCC-AGT-CAC-3'). After ligaton adapters were depleted by an XP bead purification (Beckman Coulter) adding bead in a ratio of 1:1. Indexing was done during the following PCR enrichment (15 cycles) using custom amplification primers carring the index sequence indicated with ‘NNNNNN’. (Primer1: Oligo_Seq AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, primer2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, primer3: CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTT. After two more XP beads purifications (1:1) libraries were quantified using Qubit dsDNA HS Assay Kit (Invitrogen). For Illumina flowcell production, samples were equimolarly pooled and distributed on all lanes used for 75bp single read sequencing on Illumina HiSeq 2500.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Alignment of the short reads to the mm9 transcriptome was performed with pBWA, version 0.5.9-r32-MPI-patch2 (Peters et al., 2011).
Counts per gene were computed based on the Ensembl Genes v.67 annotation for mouse using BEDtools (v. 2.11).
Normalization of the raw readcounts based on the library size and testing for differential expression between the different cell types/treatments was performed with the DESeq R package (v.1.10.1)
Genome_build: mm9
Supplementary_files_format_and_content: p363_PROCESSED_RNA-SEQ.xlsx contains genes being differentially expressed and the complete counts table for all samples. For analysis raw data fastq files for individual samples were merged.
|
| |
|
| Submission date |
May 28, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Anthony Gavalas |
| Organization name |
TU Dresden
|
| Street address |
Fetscherstr. 105
|
| City |
Dresden |
| ZIP/Postal code |
01307 |
| Country |
Germany |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE58025 |
Aldehyde dehydrogenase activity is necessary for beta cell development and functionality in mice |
|
| Relations |
| BioSample |
SAMN02801754 |
| SRA |
SRX554693 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
