|
| Status |
Public on Jul 30, 2014 |
| Title |
QB2 |
| Sample type |
SRA |
| |
|
| Source name |
Posterior silk gland
|
| Organism |
Bombyx mori |
| Characteristics |
strain: Qiufeng×Baiyu
Stage: fifth instar day 3 to day 8 before spinning
tissue: Posterior silk gland
|
| Treatment protocol |
Posterior silk glands were manually dissected and collected day by day from the fourth instar molting to day 8 of the fifth instar that before spinning at low temperature in 0.7% NaCl solution, rinsed and stored in liquid nitrogen immediately.
|
| Growth protocol |
Domesticated silkworms (Bombyx mori), was reared at 25°C on a natural diet of clean mulberry leaves.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
total RNA
Total RNA of each sample was immediately isolated from posterior silk gland of silkworm using Trizol reagent for RNA isolation. Following purification, total RNA samples were immediately preserved in ethanol and stored at -80℃ until further use. For deep sequencing, the total RNA samples were prepared as follows: total RNA of each sample was size-fractionated on a 15% PAGE gel, and a 16–30 nt fraction collected. The 5′ RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) was ligated to the RNA pool with T4 RNA ligase. Ligated RNA was size-fractionated on a 15% agarose gel, and a 40–60 nt fraction excised. The 3′RNA adapter (5’-pUCGUAUGCCGUCUUCUGCUUGidT-3’; p, phosphate; idT, inverted deoxythymidine) was subsequently ligated to precipitated RNA using T4 RNA ligase. Ligated RNA was size-fractionated on a 10% agarose gel, and the 70-90 nt fraction (total RNA + adaptors) excised. Small RNAs ligated with adaptors were subjected to RT-PCR (Superscript II reverse transcriptase, 15 cycles of amplification) to produce sequencing libraries. PCR products were purified and total RNA libraries sequenced using Solexa sequencing technology.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
Run Solexa pipeline [*fq]
Remove low qulity reads strictly
Trim 3' adaptor sequenceclean.txt].
Remove 5' adaptor contaminants
Plot data distribution
|
| |
|
| Submission date |
Mar 31, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Boxiong Zhong |
| E-mail(s) |
bxzhong@zju.edu.cn
|
| Organization name |
Zhejiang University
|
| Lab |
Silkworm Genetics Lab
|
| Street address |
Yuhangtang Road 866
|
| City |
HangZhou |
| State/province |
Zhejiang province |
| ZIP/Postal code |
310058 |
| Country |
China |
| |
|
| Platform ID |
GPL15780 |
| Series (1) |
| GSE56380 |
MicroRNA expression profiling of the fifth-instar posterior silk gland of Bombyx mori |
|
| Relations |
| BioSample |
SAMN02712371 |
| SRA |
SRX504611 |
