NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1300044 Query DataSets for GSM1300044
Status Public on Jan 03, 2014
Title IgH_Tcells23
Sample type SRA
 
Source name activated splenic T cells
Organism Mus musculus
Characteristics genotype: IgH2-28xI
activation protocol: ConcanavalinA/IL-2
cell type: activated splenic T cells
Extracted molecule genomic DNA
Extraction protocol Cells were lysed in the presence of proteinaseK, and genomic DNA was Ethanol-precipitated, then resuspended. Genomic DNA was sonicated to fragment size 200-500bp.
HTGTS libraries were constructed with the adapter-PCR method as described in Chiarle et al., Cell, 2011. Libraries were prepared for sequencing with MiSeq Illumina kit MS-102-2003, according to instructions.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Data processing Library strategy: HTGTS
Standard basecalling formats for Miseq reads
Paired end reads required trimming and stitching using ea-utilsv1.1.2 (http://code.google.com/p/ea-utils) followed by CD-HITv4.5 (Li & Godzik, Bioinformatics 2006) to remove 100% duplicates
Miseq reads are aligned using Blat (Kent, Genome Research 2002). Reads containing artifacts or duplicate junctions were removed.
For alignment of reads from IgH B and T cell libraries, the reference genome was modified to delete the Smu region (chr12:114661018-114664694) and include an I-SceI site target (sequence: TCGAGGTCGAAATAGGGATAACAGGGTAATAATTATTACCCTGTTATCCCTAAATCGACCCTAGTGGGGGCGCCAAGTTAGCTTGGCTGGACGTAAACTCCTCTTCAGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTAAGGGTTATTGAATATGATCGGAATTCCTCGACATCGATGCATCGATGCATCGATGCATCGATGTCGAGT) at position chr12:114661018
For alignment of reads from c-myc B cell libraries, the reference genome was modified to include an I-SceI site target (sequence: GATCGAATTCGTCGACCGCCGCTAATTCCGATCATATTCAATAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGAGGAATTCTGCAGATTAGGGATAACAGGGTAATAATTATTACCCTGTTATCCCTAATCCATCACACTGGCGGCCC) at position chr15:61914629
Genome_build: mm9
Supplementary_files_format_and_content: tab delimited text files containing filtered unique junctions and including the following information: sequence ID (Qname); blat score (score); beginning (Qstart) and end (Qend) nucleotide position within the read of alignment; orientation of junction (strand); chromosome (Tname) and position (Tstart and Tend) of alignment to the genome build; the entire read sequence (raw) including stitched paired end reads; and the RefGene feature the alignment is associated with (Genes; NA=no annotation)
 
Submission date Jan 02, 2014
Last update date May 15, 2019
Contact name Frederick Alt
Organization name Boston Children's Hospital
Department Program in Cellular and Molecular Medicine
Street address 1 Blackfan Circle
City Boston
State/province MA
ZIP/Postal code 02155
Country USA
 
Platform ID GPL16417
Series (1)
GSE53755 Long-range joining of intra-chromosomal DNA double-strand breaks
Relations
BioSample SAMN02566796
SRA SRX403887

Supplementary file Size Download File type/resource
GSM1300044_IgH_Tcells23.good.txt.gz 22.7 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap