 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 12, 2014 |
| Title |
Sp1_E14_Flk1Plus |
| Sample type |
SRA |
| |
|
| Source name |
Sp1 from E14 Flk1Plus
|
| Organism |
Mus musculus |
| Characteristics |
cell type: E14 FLK1+
strain: C57BL/6
chip antibody: anti-Sp1 antibody (Santa Cruz sc-17824X)
|
| Growth protocol |
ES cells were trypsinised and allowed to form embryoid bodies by plating in base methylcellulose (Stem Cell Technologies M3134) supplemented with 10% FCS, 100 units/ml Penicillin and 100 µg/ml Streptomycin, 1 mM glutamine, 0.15 mM MTG, 10 ug/ml insulin (Sigma), 5% IL-3 conditioned media, 10 ng/ml recombinant mouse M-CSF (R&D Systems), 100 units/ml IL-1 (Peprotech) at a cell concentration previously determined to give similar numbers of EB. After at least 14 days EB were counted and assessed for the number of EB.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Flk1+ve sorted cells and c-kit+ve sorted floating progenitors from Day 3 blast culture were used for ChIP-seq analysis. Cells were crosslinked for 10 min at room temperature with 1% formaldehyde (Pierce, Rockford, IL, USA) and quenched with 1/10th volume 2 M glycine. Nuclei were prepared essentially as described in Lefevre et al 2003, sonicated using a Bioruptor water bath in immunoprecipitation buffer I (25 mM Tris 1 M, pH 8.0, 150 mM NaCl, 2 mM EDTA, pH 8.0, 1 % TritonX-100 and 0.25 % SDS). After centrifugation the sheared 0.5-2 kb chromatin fragments (1-2 x 106 cells) were diluted with 2 volumes immunoprecipitation buffer II (25 mM Tris, pH 8.0, 150mM NaCl, 2 mM EDTA, pH 8.0, 1% TritonX-100, 7.5% glycerol) and precipitation was carried out for 2-3 hours at 4 °C using 2 µg anti-Sp1 antibody (Santa Cruz sc-17824X) coupled to 15 µl Protein-G dynabeads. Beads were washed with low salt buffer (20 mM Tris 1 M, pH 8.0, 150 mM NaCl, 2 mM EDTA, pH 8.0, 1% TritonX-100, 0.1% SDS), high salt buffer (20 mM Tris, pH 8.0, 500 mM NaCl, 2 mM EDTA, pH 8.0, 1% TritonX-100, 0.1% SDS), LiCl buffer (10 mM Tris, pH 8.0, 250 mM lithium chloride, 1 mM EDTA, pH 8.0, 0.5% NP40, 0.5 % sodium-deoxycholate) and TE pH 8.0 containing 50 mM sodium chloride. The immune complexes were eluted in 100 µl elution buffer (100 mM NaHCO3, 1 % SDS) and after adding 5 µl 5M sodium chloride and proteinase K, the crosslinks were reversed at 65°C overnight. DNA was extracted using the Ampure PCR purification kit (Beckman Coulter) according to manufacturer’s instructions and analysed by qRT-PCR. Libraries of DNA fragments from chromatin immunoprecipitation were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Ampure PCR purification kit (Beckman Coulter). ‘A’ bases were added to 3’ ends of fragments using Klenow Fragment (3´- 5´ exo-), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further Ampure clean up to remove excess adaptors, fragments were amplified in an 18-cycle PCR reaction using adapter-specific primers (5’-CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5’-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T). The libraries were purified and adapter dimers removed by running the PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 µl of each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subjected to massively parallel DNA sequencing on an Illumina Genome Analyzer IIx.
DNA from in vivo treated cells was run on an agarose gel and fragments were excised and isolated. This DNA was used to prepare the libraries, according to Illumina's sample preparation protocol
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
Sample 1
|
| Data processing |
The raw sequence reads were aligned to the mm10 mouse genome build using BWA (Li and Durbin 2010).
The reads in the resulting alignment files in sam format were used to generate density maps using bedtools
Peaks were called using MACS (Zhang et al. 2008) and cisGenome (Ji et al. 2008)
Genome_build: mm10
Supplementary_files_format_and_content: wig files were generated using samtools and bedtools
|
| |
|
| Submission date |
Nov 19, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Salam Adli Assi |
| E-mail(s) |
s.a.assi@bham.ac.uk
|
| Organization name |
University of Birmingham
|
| Department |
Institute for Cancer and Genomic Sciences
|
| Street address |
IBR
|
| City |
Birmingham |
| ZIP/Postal code |
B15 2TT |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL11002 |
| Series (2) |
| GSE52496 |
A crucial role of the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification [ChIP-Seq] |
| GSE52499 |
A crucial role of the ubiquitously expressed transcription factor Sp1 at early stages of hematopoietic specification |
|
| Relations |
| BioSample |
SAMN02412449 |
| SRA |
SRX378972 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1267913_Sp1_E14_Flk1Plus.wig.gz |
388.4 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
