NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1204984 Query DataSets for GSM1204984
Status Public on Jun 19, 2014
Title siRNA polQ replication timing 1
Sample type genomic
 
Channel 1
Source name neosynthetized DNA in early S phase
Organism Homo sapiens
Characteristics cell line: RKO
transfection: polQ siRNA
Treatment protocol RKO cells were transfected with siRNA targeting either POLQ by two independent pools of siRNA : POLQ-1 siRNA: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon (Thermo Fisher Scientific, Waltham, USA): CCUUAAGACUGUAGGUACU, ACACAGUAGGCGAGAGUAU, CGACUAAGAUAGAUCAUUU, CAAACAACCCUUAUCGUAAA; siRNA POLQ-2: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon: UCAGAGGGAUGGAGCUAAU, GAGAUUACCCUUUCACCUA, CAAUUUUACAGUACGGAAA, UGAUAGAUUAGCCUAGUA) or Luciferase (CTRL) (5’-CGUACGCGGAAUACUUCGAdTdT-3’ from Sigma-Aldrich, Saint-Louis, USA) at the final concentration of 50nM, by using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s suggestions. Transfection medium was changed 8 hours later to complete medium.
Growth protocol Human RKO cell line was purchased from ATCC and grown in Dulbecco’s Modified Eagle Medium with GlutaMAX™ I, High glucose, Sodium Pyruvate (Gibco, Life technologies, Paisley, UK), supplemented with 10% Foetal Bovine Serum (Lonza, Basel, CH), penicillin (100U/ml) and streptomycin (100µg/ml) (Gibco) at 37°C, 5% CO2 and 5% O2 (standard culture conditions).
Extracted molecule genomic DNA
Extraction protocol 24h after transfection with POLQ-1 or CTRL siRNA, RKO cells were incubated with BrdU (50µM) for one hour, then collected, washed three times in PBS, fixed in 75% ethanol, and stored at −20°C. Fixed cells were re-suspended in PBS first with RNAse (0.5 mg/ml) and then with propidium iodide (PI) (50 µg/ml) following by an incubation of 30 min at room temperature. 80,000 cells were sorted in two fractions S1 and S2 using INFLUX 500 (Cytopeia purchased by BD Biosciences) corresponding to Early and Late fractions respectively. Neo-synthesized DNA was immunoprecipited by BrdU antibodies (Anti BrdU Pure, BD Biosciences, # 347580) as described by Hiratani et al 2008. To control the quality of enrichment of early and late fractions in S1 and S2, qPCR was performed with CAV2 oligonucleotides (early control) and with bgGRM8 oligonucleotides (late control).
Label Cy3
Label protocol Microarray hybridization requires a minimum of 500 ng of DNA and to obtain sufficient specific immunoprecipited DNA, whole genome amplification was conducted (WGA, Sigma). To be sure that this step does not introduce bias, an after WGA qPCR was performed to confirm the specific enrichment in each fractions S1 and S2. After amplification, early and late neo-synthesized DNA were labeled with Cy3 and Cy5 ULS molecules (Genomic DNA labeling Kit, Agilent) as recommended by the manufacturer.
 
Channel 2
Source name neosynthetized DNA in late S phase
Organism Homo sapiens
Characteristics cell line: RKO
transfection: polQ siRNA
Treatment protocol RKO cells were transfected with siRNA targeting either POLQ by two independent pools of siRNA : POLQ-1 siRNA: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon (Thermo Fisher Scientific, Waltham, USA): CCUUAAGACUGUAGGUACU, ACACAGUAGGCGAGAGUAU, CGACUAAGAUAGAUCAUUU, CAAACAACCCUUAUCGUAAA; siRNA POLQ-2: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon: UCAGAGGGAUGGAGCUAAU, GAGAUUACCCUUUCACCUA, CAAUUUUACAGUACGGAAA, UGAUAGAUUAGCCUAGUA) or Luciferase (CTRL) (5’-CGUACGCGGAAUACUUCGAdTdT-3’ from Sigma-Aldrich, Saint-Louis, USA) at the final concentration of 50nM, by using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s suggestions. Transfection medium was changed 8 hours later to complete medium.
Growth protocol Human RKO cell line was purchased from ATCC and grown in Dulbecco’s Modified Eagle Medium with GlutaMAX™ I, High glucose, Sodium Pyruvate (Gibco, Life technologies, Paisley, UK), supplemented with 10% Foetal Bovine Serum (Lonza, Basel, CH), penicillin (100U/ml) and streptomycin (100µg/ml) (Gibco) at 37°C, 5% CO2 and 5% O2 (standard culture conditions).
Extracted molecule genomic DNA
Extraction protocol 24h after transfection with POLQ-1 or CTRL siRNA, RKO cells were incubated with BrdU (50µM) for one hour, then collected, washed three times in PBS, fixed in 75% ethanol, and stored at −20°C. Fixed cells were re-suspended in PBS first with RNAse (0.5 mg/ml) and then with propidium iodide (PI) (50 µg/ml) following by an incubation of 30 min at room temperature. 80,000 cells were sorted in two fractions S1 and S2 using INFLUX 500 (Cytopeia purchased by BD Biosciences) corresponding to Early and Late fractions respectively. Neo-synthesized DNA was immunoprecipited by BrdU antibodies (Anti BrdU Pure, BD Biosciences, # 347580) as described by Hiratani et al 2008. To control the quality of enrichment of early and late fractions in S1 and S2, qPCR was performed with CAV2 oligonucleotides (early control) and with bgGRM8 oligonucleotides (late control).
Label Cy5
Label protocol Microarray hybridization requires a minimum of 500 ng of DNA and to obtain sufficient specific immunoprecipited DNA, whole genome amplification was conducted (WGA, Sigma). To be sure that this step does not introduce bias, an after WGA qPCR was performed to confirm the specific enrichment in each fractions S1 and S2. After amplification, early and late neo-synthesized DNA were labeled with Cy3 and Cy5 ULS molecules (Genomic DNA labeling Kit, Agilent) as recommended by the manufacturer.
 
 
Hybridization protocol The hybridization was performed according to the manufacturer instructions on 4× 180K human microarray (SurePrint G3 Human CGH Microarray Kit, 4x180K, AGILENT Technologies, genome reference Hg18) that covers the whole genome with one probe every 13 Kb (11 KB in RefSeq sequences).
Scan protocol Microarrays were scanned with an Agilent's High-Resolution C Scanner using a resolution of 2 µm and the autofocus option.
Description Biological replicate 1 of 2. polQ siRNA
Data processing Feature extraction was performed with the Feature Extraction 9.1 software (Agilent technologies). For each experiment, the raw data sets were automatically normalized by the Feature extraction software. Analysis was performed with the Agilent Genomic Workbench 5.0 software.
 
Submission date Aug 09, 2013
Last update date Jun 19, 2014
Contact name Jean-Charles Cadoret
E-mail(s) jean-charles.cadoret@ijm.fr
Organization name CNRS/ Université de Paris
Street address 15 rue hélène Brion
City Paris
ZIP/Postal code 75013
Country France
 
Platform ID GPL10123
Series (1)
GSE49693 Replication timing of siRNA control and siRNA PolQRKO cells

Data table header descriptions
ID_REF
VALUE log2-ratio representing early/late replication timing

Data table
ID_REF VALUE
1 2.00E-01
2 0.00E+00
3 0.00E+00
4 0.00E+00
5 0.00E+00
6 2.81E-01
7 0.00E+00
8 0.00E+00
9 0.00E+00
10 0.00E+00
11 0.00E+00
12 1.09E-01
13 0.00E+00
14 0.00E+00
15 0.00E+00
16 0.00E+00
17 8.09E-02
18 0.00E+00
19 1.73E-01
20 0.00E+00

Total number of rows: 180880

Table truncated, full table size 2804 Kbytes.




Supplementary file Size Download File type/resource
GSM1204984_polQ_rep1.txt.gz 18.7 Mb (ftp)(http) TXT
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap