|
Status |
Public on Apr 10, 2013 |
Title |
Vector_Clone12 |
Sample type |
SRA |
|
|
Source name |
Dicer f/f murine MSC cell line
|
Organism |
Mus musculus |
Characteristics |
cell type: murine MSC cell line genotype: Dicer f/f strain: C57BL/6
|
Treatment protocol |
Two independent clones of immortalized Dicer WT MSCs (Clone 6 and Clone 12) were infected with puromycin-resistant pMMP-puro retrovirus encoding vector control or Flag-HA-NR6A1.
|
Growth protocol |
Monoclonal immortalized Dicer WT MSCs were cultured in Alpha-MEM supplemented with pen/strep and 10% fetal bovine serum.
|
Extracted molecule |
polyA RNA |
Extraction protocol |
mRNA-sequencing was carried out with total RNA purified with the RNeasy reagent (Qiagen) and DNase-treated with TURBO Dnase. (Ambion). RNA libraries were prepared for sequencing using standard Illumina protocols
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
mRNAs isolated from immortalized clonal lines of Dicerf/f (Dicer WT) mesenchymal stem cells (MSCs), a fibroblast cell type present in adult bone marrow, were infected with puromycin-resistant pMMP-puro retrovirus encoding vector control.
|
Data processing |
Illumina pipeline version 1.3+ used for basecalling and sequence read generation Sequence reads were trimmed to remove traces of adapter sequence (AGATCGGAAGAGCGGTTCAGCAGGAATG). Reads were first mapped to the mouse transcriptome (UCSC annotation, genome build mm9) and un-aligned reads were then mapped to the mouse genome where possible. Read mapping was performed with TopHat version 1.2.0 using default options. Abundance estimation and differential analysis were performed using Cufflinks version 1.0.3 with default options. Genome_build: mm9 Supplementary_files_format_and_content: Microsoft Excel file includes FPKM (Fragments Per Kilobase of exon model per Million mapped fragments) value per gene for each sample
|
|
|
Submission date |
Feb 07, 2013 |
Last update date |
May 15, 2019 |
Contact name |
A Bhutkar |
Organization name |
MIT
|
Street address |
77 Massachusetts Avenue
|
City |
Cambridge |
State/province |
MA |
ZIP/Postal code |
02139 |
Country |
USA |
|
|
Platform ID |
GPL13112 |
Series (2) |
GSE44158 |
Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts [mRNA-seq_Flag-HA-NR6A1_overexpr] |
GSE44163 |
Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts |
|
Relations |
Reanalyzed by |
GSE80797 |
SRA |
SRX228560 |
BioSample |
SAMN01915290 |