NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1079792 Query DataSets for GSM1079792
Status Public on Apr 10, 2013
Title KO_let-7g_R1
Sample type SRA
 
Source name Dicer -/- murine MSC cell line
Organism Mus musculus
Characteristics cell type: murine MSC cell line
genotype: Dicer -/-
strain: C57BL/6
Treatment protocol Monoclonal immortalized Dicer WT and KO MSCs were transfected with indicated siRNAs at 20 nM using Qiagen HiPerfect transfection reagent as per manufacturer's instructions. 48 hours after transfection, cells were harvested for RNA extraction.
Growth protocol Monoclonal immortalized Dicer WT and KO MSCs were cultured in Alpha-MEM supplemented with pen/strep and 10% fetal bovine serum.
Extracted molecule polyA RNA
Extraction protocol mRNA-sequencing was carried out with total RNA purified with the RNeasy reagent (Qiagen) and DNase-treated with TURBO Dnase. (Ambion).
RNA libraries were prepared for sequencing using standard Illumina protocols
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Description mRNAs isolated from immortalized clonal lines of Dicer-/- (Dicer KO) mesenchymal stem cells (MSCs), a fibroblast cell type present in adult bone marrow, and transfected with a synthetic let-7g siRNA duplex, were analyzed.
Data processing Illumina pipeline version 1.3+ used for basecalling and sequence read generation
Sequence reads were trimmed to remove traces of adapter sequence (AGATCGGAAGAGCGGTTCAGCAGGAATG). Reads were first mapped to the mouse transcriptome (UCSC annotation, genome build mm9) and un-aligned reads were then mapped to the mouse genome where possible. Read mapping was performed with TopHat version 1.2.0 using default options. Abundance estimation and differential analysis were performed using Cufflinks version 1.0.3 with default options.
Genome_build: mm9
Supplementary_files_format_and_content: Microsoft Excel file includes FPKM (Fragments Per Kilobase of exon model per Million mapped fragments) value per gene for each sample
 
Submission date Feb 07, 2013
Last update date May 15, 2019
Contact name A Bhutkar
Organization name MIT
Street address 77 Massachusetts Avenue
City Cambridge
State/province MA
ZIP/Postal code 02139
Country USA
 
Platform ID GPL13112
Series (2)
GSE44157 Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts [RNA-seq_siRNA_transfection]
GSE44163 Let-7 represses Nr6a1 and a mid-gestation developmental program in adult fibroblasts
Relations
Reanalyzed by GSE80797
SRA SRX228554
BioSample SAMN01915284

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap