NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9901 Query DataSets for GPL9901
Status Public on Jan 11, 2011
Title SMD Print_745 Mycobacterium tuberculosis
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Mycobacterium tuberculosis
Manufacturer Stanford Functional Genomics Facility, Stanford School of Medicine
Manufacture protocol Material is transferred from microtiter plate wells to the slide surface by an automated print head
Support glass
 
 
Submission date Jan 11, 2010
Last update date Jan 11, 2011
Contact name Mario A Flores Valdez
E-mail(s) floresvz@yahoo.com
Organization name Centro de Investigación y Asistencia en Tecnología y diseño del Estado de Jalisco, A.C.
Department Col. Colinas de la Normal
Street address Av. Normalistas No. 800
City Guadalajara
State/province Jalisco
ZIP/Postal code CP44270
Country Mexico
 
Samples (23) GSM495672, GSM495675, GSM495676, GSM495684, GSM495685, GSM495686 
Series (2)
GSE8839 Inhibition of Respiration by Nitric Oxide Induces a Mycobacterium tuberculosis Dormancy Program
GSE19838 Gene expression profiles of M. tuberculosis constitutively expressing the transcriptional regulator DosR (Rv3133c).

Data table header descriptions
ID
MetaColumn
MetaRow
Column
Row
Reporter Name
ORGANISM
Reporter BioSequence [length]
Reporter BioSequence [Actual Sequence]
Repoter Biosequence Type
Repoter BioSequence PolymerType
Reporter Group[role]
Reporter ControlType
CompositeSequence BioSequence [Gene Name]
ORF ORF Name
CompositeSequence Biosequence Type
CompositeSequence BioSequence PolymerType
SPOT_ID

Data table
ID MetaColumn MetaRow Column Row Reporter Name ORGANISM Reporter BioSequence [length] Reporter BioSequence [Actual Sequence] Repoter Biosequence Type Repoter BioSequence PolymerType Reporter Group[role] Reporter ControlType CompositeSequence BioSequence [Gene Name] ORF CompositeSequence Biosequence Type CompositeSequence BioSequence PolymerType SPOT_ID
1 1 1 1 1 RV0001-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental dnaA RV0001 gene DNA
18 1 1 1 2 RV0059-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV0059 gene DNA
35 1 1 1 3 RV0417-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental thiG RV0417 gene DNA
52 1 1 1 4 RV0775-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV0775 gene DNA
69 1 1 1 5 RV0845-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV0845 gene DNA
86 1 1 1 6 RV1203C-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV1203C gene DNA
103 1 1 1 7 RV1561-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV1561 gene DNA
120 1 1 1 8 RV1619-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV1619 gene DNA
137 1 1 1 9 RV1977-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV1977 gene DNA
154 1 1 1 10 RV2335-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental cysE RV2335 gene DNA
171 1 1 1 11 RV2693C-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV2693C gene DNA
188 1 1 1 12 RV2763C-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental dfrA RV2763C gene DNA
205 1 1 1 13 RV3121-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental cyp141 RV3121 gene DNA
222 1 1 1 14 RV3467-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV3467 gene DNA
239 1 1 1 15 RV3537-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV3537 gene DNA
256 1 1 1 16 RV3895C-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV3895C gene DNA
273 1 1 1 17 ORFD0390-oligo Mycobacterium tuberculosis CSU#93 CCGGGTTTTACGGGCCGACACGATGCGTAGCGACCAGGTGATGTCGCTCGGACGTGTCATCCTCGTCTTG ss_oligo DNA Experimental ORFD0390-oligo
2 1 1 2 1 RV0003-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental recF RV0003 gene DNA
19 1 1 2 2 RV0073-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental RV0073 gene DNA
36 1 1 2 3 RV0419-pcr Mycobacterium tuberculosis PCR_amplicon DNA Experimental lpqM RV0419 gene DNA

Total number of rows: 4608

Table truncated, full table size 503 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL9901_Print_745.adf.gz 109.3 Kb (ftp)(http) ADF

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap