NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9283 Query DataSets for GPL9283
Status Public on Nov 30, 2009
Title Genopal Human 216 Autoimmunity Array v.1
Technology type spotted oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Mitxubishi Rayon Co., Ltd
Manufacture protocol Custom-made fibrous oligonucleotide DNA microarray GenopalTM (Mitsubishi Rayon) with a total of 216 genes which were selected from autoimmune disease related genes.

All oligonucleotide capture probes (65 mer in length), including those for negative controls, were designed to have approximately the same annealing temperature (Tm)  throughout a microarray. In addition, they were designed also to hybridize to the target antisense RNA specifically with a domain within 1 kb from 3’-end.

The oligonucleotide DNA microarray, GenopalTM (Mitsubishi Rayon), was made in the following manner. Plastic hollow fibers, in which oligonucleotide capture probes were chemically bonded to hydrophilic gel, were bundled in an orderly arrangement, hardened with resin to form a block (12 rows × 19 columns) and then sliced into thin chips. Finally, three thin chips were set into a holder together.
Support other
 
 
Web link http://www.mrc.co.jp/genome/e/index.html
Contributor(s) Fukushima T, Tougan T, Ishii T, Kobayashi S, Akita T, Nojima H
Submission date Sep 24, 2009
Last update date Nov 30, 2009
Contact name Daisuke Okuzaki
E-mail(s) dokuzaki@biken.osaka-u.ac.jp
Phone +81-6-6879-4935
Organization name Osaka univ.
Department Immunology Frontier Research Center
Lab Human Immunology (Single Cell Genomics)
Street address Yamadaoka 3-1
City Suita
State/province Osaka
ZIP/Postal code 565-0871
Country Japan
 
Samples (14) GSM455888, GSM455889, GSM455890, GSM455891, GSM455892, GSM455893 
Series (2)
GSE18247 Focused transcription profiling of peripheral blood mononuclear cells from vasculitis patients
GSE18316 Genopal: a novel platform for focused microarray analysis

Data table header descriptions
ID
GB_ACC RefSeq or GenBank Accession number for which probe sequence was designed
GENE_SYMBOL Gene symbol
SEQUENCE Nucleotide sequence of oligonucleotide probe
Block Block on the array
Row Row in each block
Col Column in each block
Gene_Desc Gene description
SPOT_ID

Data table
ID GB_ACC GENE_SYMBOL SEQUENCE Block Row Col Gene_Desc SPOT_ID
1 1 1 1 --
2 NM_021184 C6orf47 TAAGAGAGTGGTTGGGAAACCCAGGGTGTTCCTTGGATCTCAGGATCTGAGCCATCGAGGGAAGA 1 1 2 Homo sapiens chromosome 6 open reading frame 47 (C6orf47), mRNA [NM_021184]
3 NM_005720 ARPC1B ATGTGAAGAGCTTGGAGTCAGCCTTGAAGGACCTCAAGATCAAATGACCTGTGAGGAATATGTTG 1 1 3 Homo sapiens actin related protein 2/3 complex, subunit 1B, 41kDa (ARPC1B), mRNA [NM_005720]
4 NM_001903 CTNNA1 TCACTGTTCGTCACTCAAATGAATTTGCTAAATACAACACTGATACTAGATTCCACAGGGAAATG 1 1 4 Catenin (cadherin-associated protein), alpha 1, 102kDa
5 NM_017523 XAF1 ACTTATAAGTAGAAGCTAAACATTGAGTACACATGGATACAAAGAAGGGAACCGCAGACACTGGG 1 1 5 XIAP associated factor-1
6 NT_032977 ENST00000321792 TATGAGATAATTTTGTTAAAGTTGGCTTGCTTGGGCGGGTGCTTGGTCCAGAGGGAGAAAAGAAG 1 1 6 Homo sapiens mRNA; cDNA DKFZp547N1117 (from clone DKFZp547N1117). [AL832554]
7 NM_016145 C19orf56 TTCCTGCAGCGGAAGAGGCGTGATCTGGCCTTCGACTCGCTATGTCCACTAACAATATGTCGGAC 1 1 7 Chromosome 19 open reading frame 56
8 NM_002003 FCN1 CTAGTGGGGAGGCCACACCCACAAGCGCTGCGTCGTGGAAGTCACCCCATTTCCCCAGCCAGACA 1 1 8 Ficolin (collagen/fibrinogen domain containing) 1
9 NM_018098 ECT2 GCCATCAGTTTTACTAATCTTCTGTGAAATGCATAGATATGCGCATGTTCAACTTTTTATTGTGG 1 1 9 Epithelial cell transforming sequence 2 oncogene
10 NM_139177 SLC39A11 TCTCAGAGTTTACACATTCAATTGCTTCCAAGGGTGAATCTCCTGCTCTGTGAATGCTATCAGAC 1 1 10 Solute carrier family 39 (metal ion transporter), member 11
11 NM_031892 SH3KBP1 TTATCCAAGTCCACTAGAGGCCACTGTCTTCAAAGCTTCTCTCACCCTAGCCAAAGGTCCTAAGA 1 1 11 SH3-domain kinase binding protein 1
12 NM_004146 NDUFB7 AAGAAGGCGGCAGAGTTGGCCAAAGGCCAGGGACCCGGGGAAGTGGACCCCAAGGTGGCCCTGTA 1 1 12 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa
13 NM_006821 ACOT2 TGTTCCTGGTAGGTCAGGATGACCACAACTGGAAGAGTGAGTTCTATGCTAATGAGGCCTGTAAA 1 1 13 Acyl-CoA thioesterase 2
14 NM_000199 SGSH ATGCCCGTCCTCTGGCTTGGGTTAATTCTTGGATGACGTCGGCGTTGCTGGGAGAATGTGCCGTT 1 1 14 Homo sapiens N-sulfoglucosamine sulfohydrolase (sulfamidase) (SGSH), mRNA [NM_000199]
15 NM_015046.5 SETX AGCTGCGATTTGGCAAACAGCCCTGTTGTCTTTGTTAAACCCTAAATTTTAAGAGGAAATGGCAG 1 1 15 Senataxin
16 NM_002496 NDUFS8 AGTGGCAGCCACCTACAAGTATGTGAACATGCAGGATCCCGAGATGGACATGAAGTCAGTGACTG 1 1 16 Homo sapiens NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) (NDUFS8), mRNA [NM_002496]
17 NM_003254 TIMP1 AGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCT 1 1 17 Homo sapiens TIMP metallopeptidase inhibitor 1 (TIMP1), mRNA [NM_003254]
18 NM_006122 MAN2A2 AATCAACGAGTACAATTACTTTAGGAGAAAAGCTTGCTTCAGGGTCCTTAGAGAAAGTCACTGGG 1 1 18 Mannosidase, alpha, class 2A, member 2
19 1 1 19 --
20 NM_001008895 CUL4A AGAGTCTCTTTTTGAAACATGCGGGTTTGAAATATGACACCTTGTGGGTTTCCATATTAAAATCC 1 2 1 Cullin 4A

Total number of rows: 219

Table truncated, full table size 30 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL9283_aGp.txt.gz 12.6 Kb (ftp)(http) TXT

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap