NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5729 Query DataSets for GPL5729
Status Public on May 06, 2008
Title NKI/VanSteensel_HSA_390k_chr4_v070809
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer nimblegen
Manufacture protocol Details on the manufacture protocol can be found on http://www.nimblegen.com/technology/index.html
Catalog number 4574
Support glass
 
Description Non-repetitive part of Human chromosomes HSA4. Probe spacing approximately 200bp. Based on Human genome sequence NCBI 36.
 
Web link http://www.nki.nl/nkidep/vansteensel
Contributor(s) Pagie L, Guelen L, van Steensel B
Submission date Aug 09, 2007
Last update date May 06, 2008
Contact name Bas van Steensel
E-mail(s) b.v.steensel@nki.nl
Phone + 31 20 512 2040
Fax +31 20 669 1383
URL http://www.nki.nl/nkidep/vansteensel
Organization name Netherlands Cancer Institute
Department division of Molecular Biology
Lab van Steensel group
Street address Plesmanlaan 121
City Amsterdam
ZIP/Postal code 1066 CX
Country Netherlands
 
Samples (2) GSM220166, GSM220167
Series (2)
GSE8854 Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions
GSE51334 DNA replication-timing boundaries separate stable chromosome domains with cell-type-specific functions

Data table header descriptions
ID
SEQUENCE nucleotide sequence of the oligo
SPOT_ID this array contains features with sequences corresponding to the human genome (NCBI 36) as well as different control spots
SPOT_CLASS this array contains empty spots and different classes of control spots from the manufacturer
CHROMOSOME human chromosome to which the oligo sequence maps
RANGE_START indicates the start position (relative to the RANGE_GB accession)
RANGE_END indicates the end position (relative to the RANGE_GB accession)
RANGE_GB GenBank accession number
RANGE_STRAND indicates the strand represented
X column number of feature on array
Y row number of feature on array

Data table
ID SEQUENCE SPOT_ID SPOT_CLASS CHROMOSOME RANGE_START RANGE_END RANGE_GB RANGE_STRAND X Y
4574_0425_0653 CATGGTGTATCCATGTAGCTGAATTTCTTCAGCATTTGCTTTTTTAATTTGTATAAGGAG HOMOCHR40000357086 4 90907023 90907083 NC_000004.10 + 425 653
4574_0427_0653 TACTAAAATTAGGACTAGTAATTAAATCAACTTTATTTTATCCCTTAAGTTTTATAGATG HOMOCHR40000698398 4 176924386 176924446 NC_000004.10 + 427 653
4574_0429_0653 GCATATTATCCAATACCTGTTTAATAATCAATTCTAGGCTTTTGAAATGCAGCCATAGGC HOMOCHR40000223020 4 57390314 57390374 NC_000004.10 + 429 653
4574_0431_0653 GATGATAGTGATAGTGTGGGGAAGATTTATACAATTCCCCTCATAGACCACTAATAGAGT HOMOCHR40000240420 4 61887325 61887385 NC_000004.10 + 431 653
4574_0433_0653 CCTTGCTTTATGAACACTAGTTCATTTTAATGTTGATATTCATGGAAACTACATTTATTG HOMOCHR40000215678 4 55825268 55825328 NC_000004.10 + 433 653
4574_0435_0653 GTGTTCAGTCTTACTGCTGCGTCTCGCCAGAAGGAATAGGAATTCAGGAACAGGAAACAC HOMOCHR40000029122 4 7036610 7036670 NC_000004.10 + 435 653
4574_0437_0653 TGCCACCTAGTCTTTCACCTTGAACTTATTTTAGAGCAATGTCATGGTTTTCTTTATAAG HOMOCHR40000540709 4 137748668 137748728 NC_000004.10 + 437 653
4574_0439_0653 GCTCACACTCAAGAGAAAGCAAATATGAAACATGACCTCCATTGTGTTCTGGACCTCGTG HOMOCHR40000365650 4 93128439 93128499 NC_000004.10 + 439 653
4574_0441_0653 TAGATTCAACAAAATCCCCCTCAAATCCCAGATGACTTTTGTACAGAAAACTACAAGCTG HOMOCHR40000710780 4 180109936 180109996 NC_000004.10 + 441 653
4574_0443_0653 CAGGTAGAGAAAAGACAAATCACCTGTAAAGAGATGACAATTAAAGTGTAAAAATGGAAG HOMOCHR40000387979 4 98932180 98932240 NC_000004.10 + 443 653
4574_0445_0653 GGTTTCTTTAAACAGGCAATGTAGCTGAATGCAGCAAAAGTGAGTGAAGGAAAACCCAGC HOMOCHR40000281952 4 72923980 72924040 NC_000004.10 + 445 653
4574_0447_0653 CCCTCCCTTTTTCCTATGAGAGCACATAGTCTGTGTTGATTGTGGGTTGTGTAGACAGGC HOMOCHR40000590203 4 149786523 149786583 NC_000004.10 + 447 653
4574_0449_0653 GCCGACATGCCTAACGCCCCGGGAGCTGCATCATTTGAATATTTTTGACTCTAAATATAG HOMOCHR40000739571 4 186943022 186943082 NC_000004.10 + 449 653
4574_0451_0653 TTCATCAGCAAGAATTCCTAAGGTTTCAGATTTCTCAATCTATGAGGAGTGACTTCTTTC HOMOCHR40000166549 4 40712082 40712142 NC_000004.10 + 451 653
4574_0453_0653 GTCCTGGAAAAAAACAGTCAAGCTGATACAAGCTGGAGCAGGCTCCCAGCAGCCACGGGG HOMOCHR40000611218 4 154889178 154889238 NC_000004.10 + 453 653
4574_0455_0653 CACTAGAAAATGTAAGTGTTTCTCACTAACAAAATTAAAATAAAGCTAGTCATATGCCTT HOMOCHR40000246106 4 63374024 63374084 NC_000004.10 + 455 653
4574_0457_0653 GAGCTAGCAAGTGCTACGGAATGTCTGCAGAGAGTAATTACATAGAGACAAGTGTCTTTA HOMOCHR40000624656 4 158276838 158276898 NC_000004.10 + 457 653
4574_0459_0653 CATATAGTCTCCTCCTGAAGATTTACATATTGGCAAGTAAAGGAAAATTAAGGCCAACTC HOMOCHR40000467652 4 118984492 118984552 NC_000004.10 + 459 653
4574_0461_0653 TCTCCTAAAAAAAAATAGAGCCTCTTTCTCTCTATTCTGAGCCACCTAGAGCTTGGGGTG HOMOCHR40000421457 4 107296813 107296873 NC_000004.10 + 461 653
4574_0463_0653 GGTAGATTGGCTACTGTCCAGGAAAGAGGTGTGATAGTCTGTATCCAGAAACAAAGTGAG HOMOCHR40000535901 4 136423841 136423901 NC_000004.10 + 463 653

Total number of rows: 392714

Table truncated, full table size 53218 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap