NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5648 Query DataSets for GPL5648
Status Public on May 06, 2008
Title NKI/VanSteensel_HSA_390k_3/8_v070724
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer nimblegen
Manufacture protocol Details on the manufacture protocol can be found on http://www.nimblegen.com/technology/index.html
Catalog number 5096
Support glass
 
Description Non-repetitive part of Human chromosomes HSA6, HSA12, HSA20. Probe spacing approximately 750bp. Based on Human genome sequence NCBI 36. Platform 3 of 8, covering the whole human genome. Includes 9731 probes common to all 8 arrays of this series, used for between array normalization.
 
Web link http://www.nki.nl/nkidep/vansteensel
Contributor(s) Pagie L, Guelen L, van Steensel B
Submission date Jul 24, 2007
Last update date May 06, 2008
Contact name Bas van Steensel
E-mail(s) b.v.steensel@nki.nl
Phone + 31 20 512 2040
Fax +31 20 669 1383
URL http://www.nki.nl/nkidep/vansteensel
Organization name Netherlands Cancer Institute
Department division of Molecular Biology
Lab van Steensel group
Street address Plesmanlaan 121
City Amsterdam
ZIP/Postal code 1066 CX
Country Netherlands
 
Samples (1) GSM220160
Series (2)
GSE8854 Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions
GSE51334 DNA replication-timing boundaries separate stable chromosome domains with cell-type-specific functions

Data table header descriptions
ID
SEQUENCE nucleotide sequence of the oligo
SPOT_ID this array contains features with sequences corresponding to the human genome (NCBI 36) as well as different control spots
SPOT_CLASS this array contains empty spots and different classes of control spots from the manufacturer
CHROMOSOME human chromosome to which the oligo sequence maps
RANGE_START indicates the start position (relative to the RANGE_GB accession)
RANGE_END indicates the end position (relative to the RANGE_GB accession)
RANGE_GB GenBank accession number
RANGE_STRAND indicates the strand represented
X column number of feature on array
Y row number of feature on array

Data table
ID SEQUENCE SPOT_ID SPOT_CLASS CHROMOSOME RANGE_START RANGE_END RANGE_GB RANGE_STRAND X Y
5096_0001_0001 AGGTGTCAGTTTTACAAAATTATATAGGTGTCAGTGTACGAAGGTACACTACAGCATGTG HUMCHR12_0000078536 12 38029973 38030033 NC_000012.10 + 1 1
5096_0023_0001 GAGAATTTTTGACTGTACTGGGGGTCAGCGCCAGTGCATTGTTCAAGAGTCAACTGTATG HUMCHR12_0000269589 12 124980239 124980299 NC_000012.10 + 23 1
5096_0025_0001 GTTGTGATGACATGGCCAGCAGTGTTTCCACTCATCTACTCTGCTCTCTATAGATACAGG HUMCHR06_0000020649 6 9727817 9727877 NC_000006.10 + 25 1
5096_0027_0001 CAGGACTCGCCAAATGTCAGTAAGGCCCCTGTTGGTAGGTTAGGATTTCAGCAGAGACTG HUMCHR06_0000241976 6 118384579 118384639 NC_000006.10 + 27 1
5096_0029_0001 TTAGCCATTTCAAAATCAATCAGTGAATTAAGTAAAACAAGAAAATTTTTTTATTCTCTA HUMCHR06_0000208160 6 102121258 102121318 NC_000006.10 + 29 1
5096_0031_0001 TTCCTCAGTTGAATTGACTGTCAGAAAGTCTTTGCTTTTGGGAAAAGAGCATCACATGGG HUMCHR06_0000055873 6 25695978 25696038 NC_000006.10 + 31 1
5096_0033_0001 CAGGAAAAAGACTCTTGAGGGAAGGAAAACAAGCAAAGAAAGCTCATGACTGCCCTGACC HUMCHR06_0000142353 6 69301624 69301684 NC_000006.10 + 33 1
5096_0035_0001 CGTGCTGGTGAGGGGGCTGTGCTTTAGAAGAGATGCAGATTTTGAGATGAAAGAGCAGAC HUMCHR06_0000026055 6 12176230 12176290 NC_000006.10 + 35 1
5096_0037_0001 GGGTTTCAAACCCAGGAGACAGATACCACAACAAATGTACTAACCCTACACAATACTGGC HUMCHR12_0000089903 12 43706574 43706634 NC_000012.10 + 37 1
5096_0039_0001 GCTGAGTGCAAGTCTATGGCAGAACTGTCACTGTGATGGGAAAGCACTCCCTGGAGTTGT HUMCHR20_0000084094 20 40534094 40534154 NC_000020.9 + 39 1
5096_0041_0001 GTAGGGGAGAGCAACCTCCAGAAATTCTTTTGGCTCTGGGTGGTGCATGGGAAACAGCTG HUMCHR06_0000164194 6 80080115 80080175 NC_000006.10 + 41 1
5096_0043_0001 CACTCTCTGCACCTCAGCTTCTCTACCTATGGGTAGTAATCCCGGAGGGATGTGGTGAGG HUMCHR20_0000109496 20 51095660 51095720 NC_000020.9 + 43 1
5096_0045_0001 GCTCAATGGAATGGTGCCTTGTTCCTATTCTCTCAGCTGTTCATTTTGGTTAACCTCCTG HUMCHR12_0000079054 12 38285658 38285718 NC_000012.10 + 45 1
5096_0047_0001 CTGTGTAGCTGCTGTGCCATTGTGCATGGTGAAGATAAGTTTTTTAAAATTATTATTTTT HUMCHR06_0000040614 6 18628224 18628284 NC_000006.10 + 47 1
5096_0049_0001 TGCAGCTGGGTGCAGTAGTTCACACCTATAATTCCACAACTTGGGAGGCTGAAGTGGGAG HUMCHR12_0000082017 12 39813307 39813367 NC_000012.10 + 49 1
5096_0051_0001 CAAAGGTTTTACTCTTTTCTCTCTGGTAGTAATCACACCAGGACCCCTTTCATCTTGTAC HUMCHR20_0000016889 20 7255771 7255831 NC_000020.9 + 51 1
5096_0053_0001 GGGCCTAGGAGTCCAAAGCTGCAATTAGTTATAATAGCATCACTATGCTCCAGGGTGAGC HUMCHR06_0000167947 6 81983301 81983361 NC_000006.10 + 53 1
5096_0055_0001 GTCAACGTAGTGTGTGACACAGGCTGTGCCATGAGTTCAGGGTTTTGTCGTCTGTGCTGG HUMCHR06_0000328252 6 159604066 159604126 NC_000006.10 + 55 1
5096_0197_0001 TCATACATTATGTTACCAGATTATTCTGAAGCTCCAGATTTAGTGCATTTTAATTACTTC HUMCHR20_0000017471 20 7538352 7538412 NC_000020.9 + 197 1
5096_0199_0001 TGCATTCCAGCCCACACACGTTAGAGACATTTTTCAAACACCTAGATGAGAGAAGATAGC HUMCHR06_0000232929 6 113861359 113861419 NC_000006.10 + 199 1

Total number of rows: 388476

Table truncated, full table size 53057 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap