NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL32927 Query DataSets for GPL32927
Status Public on Dec 11, 2022
Title piTYPER MALDI-TOF MassArray PRJNA737185-Cheetah-77-v1.0.1
Technology type other
Distribution custom-commercial
Organism Acinonyx jubatus
Manufacturer .Agena Bio Inc.
Manufacture protocol Designed using methylated gene regions identified in previous studies. Primers were designed using the EpiDesigner (Agena Bio Inc.) website available at: www.epidesigner.com
 
Description https://www.agenabio.com/wp-content/uploads/2015/06/51-20055R1.0-EpiTYPER-Brochure_WEB.pdf
 
Submission date Dec 08, 2022
Last update date Dec 11, 2022
Contact name Louis St├ęphane Le Clercq
E-mail(s) leclercq.l.s@gmail.com
Organization name University of the Free State
Department Department of Genetics
Lab Conservation Genetics
Street address Genetics building, 205 Nelson Mandela Dr, Park West
City Bloemfontein
State/province FS
ZIP/Postal code 9301
Country South Africa
 
Samples (50) GSM8002893, GSM8002894, GSM8002895, GSM8002896, GSM8002897, GSM8002898 
Series (1)
GSE252541 Methylation-based markers for the estimation of age in African Cheetah, Acinonyx jubatus

Data table header descriptions
ID
GENE DESCRIPTION Full name of gene to be assayed
ORF ORF Name
GENE_ID NCBI Gene ID
CPG Number of phosphorylated Cytosine-Guanine pair in sequence
CPG_POSITION Position of CpG in amplicon
SEQUENCE Sequence of full amplicon to be analysed for methylation

Data table
ID GENE DESCRIPTION ORF GENE_ID CPG CPG_POSITION SEQUENCE
EDARA_CpG_1 Extodysplasin A receptor associated death domain EDARADD 106982554 1 42 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_2 Extodysplasin A receptor associated death domain EDARADD 106982554 2 81 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_3 Extodysplasin A receptor associated death domain EDARADD 106982554 3 119 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_4 Extodysplasin A receptor associated death domain EDARADD 106982554 4 164 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_5 Extodysplasin A receptor associated death domain EDARADD 106982554 5 228 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_6 Extodysplasin A receptor associated death domain EDARADD 106982554 6 294 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_7 Extodysplasin A receptor associated death domain EDARADD 106982554 7 366 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_8 Extodysplasin A receptor associated death domain EDARADD 106982554 8 379 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_9 Extodysplasin A receptor associated death domain EDARADD 106982554 9 429 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
EDARA_CpG_10 Extodysplasin A receptor associated death domain EDARADD 106982554 10 460 TTTGAAAGGCCAACCAGCTTTATGGCAATGCTCGAGCTTACAGTGTTAACAAGATAGCACAATTTGATATGCGGTTCCTGCCAACCAACTTTAGAAATAATTCCATCTTCGTGAGAAGTCTGCAAGAACCACAAACCAAACCTCAAAATAGATTCGAAGAGAAAATACTCTTAGAAAAAATTTCCCTTCCTATCAGAAGCAGACCAGAAGGAAGCTTACGCTCCCACTTACAAGTTCCCCAGAAAGCTTCATCTAGAAGGTTGTTACTTTCTTCAGACACACAGCGGGTCACTCTTTTCTGAGGCTCTTGCCTCTTCCATGGCCTCTTCCAGAGACTAAGACACCAATCTAGAGAGCGCCATGGGCCTCCGGACCACTAAACAGATGAGGAGAAGCACAAAACAAGCCTCTGGTCACCACGAGGGTATGTAGGTATTTGCTGCTTTTCTGCGTTTCTCAAAGCTGAGCTTTGGGCTG
ELOVL2_CpG_1 Elongation of very long fatty acids 2 ELOVL2 106972032 1 38 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_2 Elongation of very long fatty acids 2 ELOVL2 106972032 2 44 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_3 Elongation of very long fatty acids 2 ELOVL2 106972032 3 57 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_4 Elongation of very long fatty acids 2 ELOVL2 106972032 4 81 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_5 Elongation of very long fatty acids 2 ELOVL2 106972032 5 89 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_6 Elongation of very long fatty acids 2 ELOVL2 106972032 6 116 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_7 Elongation of very long fatty acids 2 ELOVL2 106972032 7 138 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_8.9 Elongation of very long fatty acids 2 ELOVL2 106972032 8.9 144.146 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_10 Elongation of very long fatty acids 2 ELOVL2 106972032 10 166 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA
ELOVL2_CpG_11 Elongation of very long fatty acids 2 ELOVL2 106972032 11 177 TTCAGAGTCAAGTACTGGCCTGGGAAACCGGGAACGAGAGTAGTTGTCGGAAAGGACACACCAGGACCCCCCGCCACCCCGCCACCCCACCACCCCCCCCCATCCCCGTTTACAAAAGGAAACCTCCCCGACTCCGCGATGCAACCCCAGGGAGGCCGGGGCAAGCACGCAGACACACCCCCGGGATTGCAGGCACGGTGCAGGGAGGAGAGGAGGCACGGATTCAACCGTTAGAGACAAAACCCCAGAATTTCCCGAGGCAGGGTCGGCACCGCGCGAGGGAAAGGCCGTCCCCCACTCCAGGGGTCGAAGGCCGGGGGAAAGCAGGGTCCGGGGGACGAGCGGGAATGGCCGCCGCGGGAGCGGGGGGCGGTTTCGTCGGGCATCCCCGGCGCCCGGCCGGCCGCGTGCTTGCAACAGGGGGCTGGA

Total number of rows: 77

Table truncated, full table size 34 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap