NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21852 Query DataSets for GPL21852
Status Public on May 11, 2016
Title 065939 Arraystar Mouse RefSeq Promoter Array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Agilent-065939
MM9
Arraystar Mouse 4x180 K RefSeq Promoter Microarrays are specifically designed for the unbias identification of epigenetic modifications and transcription factor binding sites within 22,327 mRNA promoter regions by using 60-mer tiling probes at approximately 205 bp spacing. The probes for positive, negative are also included to facilitate experimental performance assessment.

22327 RefSeq gene promoters (from -1300 to +500 bp)
 
Submission date May 10, 2016
Last update date May 11, 2016
Contact name Panos Pan
E-mail(s) panosp@arraystar.com
Phone 888-416-6343
Organization name Arraystar Inc.
Street address 9430 Key West Avenue
City Rockville
State/province MD
ZIP/Postal code 20850
Country USA
 
Samples (54) GSM2174912, GSM2174913, GSM2174914, GSM2174915, GSM2181574, GSM2181575 
Series (10)
GSE81739 Methylation profiling of 3T3-L1 Cells: Control vs slincRAD-shRNA8 stable transfected
GSE82029 DNA methylation alternations in the offspring liver from chromium restriction diet dams
GSE82030 DNA methylation alternations in the offspring adipose from chromium restriction diet dams

Data table header descriptions
ID probeID
CONTROL_TYPE
BUILD genome build
Chromosome
RANGE_GB
RANGE_START
RANGE_END
SEQUENCE
SPOT_ID

Data table
ID CONTROL_TYPE BUILD Chromosome RANGE_GB RANGE_START RANGE_END SEQUENCE SPOT_ID
MmCGHBrightCorner pos control
DarkCorner2 pos control
Ch_220697_0000355 FALSE MM9 chr10 NC_000076.5 11001167 11001211 GCGGAGGCGCAGAGGATTGGGACGGGACGGGCCCCGTGCGTGGTC
Ch_220697_0147674 FALSE MM9 chr7 NC_000073.5 142387878 142387922 CCCAGGTCTGAGGATTTGTAAAACAGCTCTGAATGCAGAGTCACG
Ch_220697_0151242 FALSE MM9 chr8 NC_000074.5 34594157 34594205 ACTGGATGGCTGTTTCTGCGCATCACTGACTCACGGTAAAGAAAAATAA
Ch_220697_0141215 FALSE MM9 chr7 NC_000073.5 75422368 75422412 AGGTAAGGTGACTTGCCAGCCTCTACTTAGCTTCACCGCTGAAAA
Ch_220697_0090609 FALSE MM9 chr2 NC_000068.6 135882870 135882928 TCTAAAGTCATGGAGAGATTCAAACTGACAACATAGGTAAAATGCTTTGCAGTTTGTCC
Ch_220697_0079588 FALSE MM9 chr1 NC_000067.5 192848828 192848875 CACTTATACGTGACCAGTAGGTGCCAAGCTGGGCTGACTACTAATACT
Ch_220697_0138955 FALSE MM9 chr7 NC_000073.5 38968046 38968090 CTAGACTGGAGTTCGCTCGCCACACTCTCTATTTGGGTGGCATTG
Ch_220697_0020158 FALSE MM9 chr11 NC_000077.5 116705023 116705067 TTTCGGTTCCGGGAGGAGCCAGTTCCCGGAGGCAATCGGGCGGTG
Ch_220697_0146073 FALSE MM9 chr7 NC_000073.5 127245578 127245622 AACTTTCACTCCAAGCCACTGCTGTAGGAAGAGACTGTCTCCAAG
Ch_220697_0103505 FALSE MM9 chr3 NC_000069.5 154259196 154259246 AAACATGGCTTGGAGAAGAGACAACAGTGTTTTGGAGACTCGTCTGAATAA
Ch_220697_0150208 FALSE MM9 chr8 NC_000074.5 19193119 19193178 GTCTATAGGTCCTAAGTATTCCTAAATCTATAGATCTGAATCTACTTTTCAGCACGAGCC
Ch_220697_0083963 FALSE MM9 chr2 NC_000068.6 61416924 61416983 TCTGACCCTTTTACTCTGTCCCTAATTTTTAAGACAGAATGGTTTATGTCTTTAATTGAG
Ch_220697_0068292 FALSE MM9 chr19 NC_000085.5 37450744 37450788 CGCCATCCATTTCTTCGGGTCACGCCCCGTCGTCACCACAGTGAC
Ch_220697_0087474 FALSE MM9 chr2 NC_000068.6 93997895 93997939 CAAGGCCTCGTTGCCCACGCACCACACCTGGAAGGCCCTGAAGAG
Ch_220697_0006277 FALSE MM9 chr10 NC_000076.5 110942846 110942895 TGGCTATTTTGCCTGTGTTCTGTGGCAGGAAAGGAAGTCAAGAATGTATA
Ch_220697_0046322 FALSE MM9 chr16 NC_000082.5 4002749 4002808 CTAATTGCTTTTCAAATCTTTAGCCCATTTAATCCTTACAGCAATACTATATAATACAAT
Ch_220697_0015225 FALSE MM9 chr11 NC_000077.5 82685213 82685258 TTTTGGCAGGCACTTAACCTTTCCAATATCTTCCCCATCCCAGAAA
Ch_220697_0082327 FALSE MM9 chr2 NC_000068.6 31006663 31006718 ATAGATACCTGAGTTAACTTTCTAGTACTCATGATGTCAGGCAACACACAACTGCC

Total number of rows: 176015

Table truncated, full table size 19675 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap