NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15656 Query DataSets for GPL15656
Status Public on Jun 05, 2012
Title NimbleGen Human CGH 385K Chromosome 21 Tiling Array [2006-09-22_HG18_CHR21_FT]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer NimbleGen
Manufacture protocol See www.nimblegen.com
 
Description Build: Hg18, NCBI 36

native array description file: 2006-09-22_HG18_CHR21_FT.ndf
native array description file: 2006-09-22_HG18_CHR21_FT.pos
 
Submission date Jun 04, 2012
Last update date Jun 05, 2012
Contact name Benjamin Pope
Organization name Florida State University
Department Biological Science
Lab David Gilbert
Street address 319 Stadium Dr
City Tallahassee
State/province FL
ZIP/Postal code 32306-4295
Country USA
 
Samples (4) GSM942928, GSM942929, GSM942930, GSM942931
Series (2)
GSE38472 Replication-Timing Boundaries Facilitate Cell-type and Species-specific Regulation of a Rearranged Human Chromosome in Mouse
GSE51334 DNA replication-timing boundaries separate stable chromosome domains with cell-type-specific functions

Data table header descriptions
ID PROBE_ID
CHROMOSOME Chromosome number
RANGE_GB GenBank accession for Chromosome
RANGE_START Probe start site
RANGE_END Probe end site
SEQ_ID The NimbleGen sequence identifier
PROBE_SEQUENCE

Data table
ID CHROMOSOME RANGE_GB RANGE_START RANGE_END SEQ_ID PROBE_SEQUENCE
CHR21FS009719783 chr21 NC_000021.7 9719783 9719841 chr21 CTTTGTGAGGGTTGGATTCATTTCACACATTTGAACATTTCTTTGATTGAAGATTTGGA
CHR21FS009719853 chr21 NC_000021.7 9719853 9719906 chr21 TGTAAAATCTATAAAGGGATAATTGTGAACCCTTTGAGGCCTAGGGTGAAGTAG
CHR21FS009720013 chr21 NC_000021.7 9720013 9720063 chr21 AAACAGTCCTATTGTAGAATCCCCAAAGGAATACTTCTCAGCCGATTGAGG
CHR21FS009720028 chr21 NC_000021.7 9720028 9720077 chr21 AGAATCCCCAAAGGAATACTTCTCAGCCGATTGAGGCCTTTGGTGATATT
CHR21FS009720123 chr21 NC_000021.7 9720123 9720181 chr21 TTATTTTTAATGAGTGCTCTCATCTCAAAGAGTTAAGTGTTTCTTTTGAATGAGCAGTT
CHR21FS009721073 chr21 NC_000021.7 9721073 9721125 chr21 TTTTGGGCCCTTTATGGCCCATGGTGAAACAGAAAATATCCTCAAAGAAAAAC
CHR21FS009721078 chr21 NC_000021.7 9721078 9721133 chr21 GGCCCTTTATGGCCCATGGTGAAACAGAAAATATCCTCAAAGAAAAACTAGACATA
CHR21FS009721418 chr21 NC_000021.7 9721418 9721474 chr21 TGAGCCCATTGAAGCCTAGGGTGAAAAAGAAATGTCTTCCCATAAAAAGTAGATAGA
CHR21FS009721578 chr21 NC_000021.7 9721578 9721633 chr21 AAAAATTTTGTGAGCCTTATACGGCCCATGGTGAAATAGGAAATATCGTCACATAA
CHR21FS009721883 chr21 NC_000021.7 9721883 9721937 chr21 CAGCAGTTTTCTAAACAGACCTTTTGTAAAATCTACAAAGTAATACTTCTGAGCC
CHR21FS009722248 chr21 NC_000021.7 9722248 9722306 chr21 TTGTATAATGTGCAAAAGGATATTTGTGAGCCCTTTCAGGACTGTGGTGAAATAGGGAA
CHR21FS009722423 chr21 NC_000021.7 9722423 9722486 chr21 AGAATCTGAAGATGGATATTTGCAGCATTTCAGGCCTATGGTGAACAGGAAATTTCTTCACATA
CHR21FS009722658 chr21 NC_000021.7 9722658 9722711 chr21 AAAAACTAGGCAGAAGCTTTTTGTAAAACTTCTTTGTACTGTGTGCTTTCACCA
CHR21FS009722663 chr21 NC_000021.7 9722663 9722718 chr21 CTAGGCAGAAGCTTTTTGTAAAACTTCTTTGTACTGTGTGCTTTCACCACAAAGAG
CHR21FS009722883 chr21 NC_000021.7 9722883 9722939 chr21 CACAGATTTGGACCTTGCTTTTCATTGAGAAGTTTGGCAACAACTCGTTTTGTAGAA
CHR21FS009723053 chr21 NC_000021.7 9723053 9723107 chr21 TCTCACTGAGTTGAACCTTTCAGTTCATTGAGCAGTGTGGAAACATGCTTTTTGT
CHR21FS009723058 chr21 NC_000021.7 9723058 9723114 chr21 CTGAGTTGAACCTTTCAGTTCATTGAGCAGTGTGGAAACATGCTTTTTGTGCAATCT
CHR21FS009723443 chr21 NC_000021.7 9723443 9723492 chr21 TTTTGTAGTATCTGCAGAGGGCTATTAGTGAGCGGACAGGCTTACAGTGA
CHR21FS009723453 chr21 NC_000021.7 9723453 9723502 chr21 TCTGCAGAGGGCTATTAGTGAGCGGACAGGCTTACAGTGAAAAAAGAAGT
CHR21FS009723608 chr21 NC_000021.7 9723608 9723668 chr21 ACTCTTTTTGTAGCATCTGCAAGAGTATACTTCTGAGCCCATTGAGACCTATTTTGAAATA

Total number of rows: 385183

Table truncated, full table size 43276 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL15656_2006-09-22_HG18_CHR21_FT.ndf.gz 20.3 Mb (ftp)(http) NDF
GPL15656_2006-09-22_HG18_CHR21_FT.pos.gz 2.8 Mb (ftp)(http) POS

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap