NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15489 Query DataSets for GPL15489
Status Public on Feb 12, 2013
Title Combimatrix 90k TomatArray 1.0
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Solanum lycopersicum
Manufacturer University of Verona - Scientific and Technological Department - Plant Functional Genomics Centre
Manufacture protocol Probes are directly synthesized on a 90k Combimatrix array by an in situ oligo synthesis system developed by Combimatrix Corporation (Mukilteo, USA) using the Combimatrix CustomArray synthesizer. Standard synthesis protocol provided by Combimatrix was used.
 
Description 20200 specific oligos (35-40mer) were designed on Tomato Gene Index Version 11 (LeGI v.11, June21, 2006) tentative consensus (TC) sequences by using the program design OligoArray 2.1 (Rouillard et al. 2003). As negative controls nine bacterial oligonucleotides sequences provided by Combimatrix were utilized. The 90K TomatArrayTM 1.0 was designed with four replicates of each probe randomly distributed across the array to allow measurement of the variability within the array. All the procedures provided were performed as indicated by Combimatrix protocols available at Combimatrix website (www.combimatrix.com)
 
Submission date Apr 25, 2012
Last update date Dec 21, 2012
Contact name Antonio Di Matteo
E-mail(s) adimatte@unina.it
Phone 00390812539208
Fax 00390812539486
Organization name University of Naples Federico II
Department DiSSPAPA
Lab Structural and functional genomics
Street address Via Universita' 100 - Parco Gussone - Edificio 75
City Portici (NA)
ZIP/Postal code 80055
Country Italy
 
Samples (22) GSM921787, GSM921788, GSM921789, GSM921790, GSM921791, GSM921792 
Series (1)
GSE37568 Comparative gene expression analysis in fruits of a tomato introgression line performing higher level of total phenolics

Data table header descriptions
ID
SPOT_ID TIGR identifier of the Tentative Consensus (TC) used for designing the specific oligonucleotide probe
GB ID GeneBank Accession Number
Annotation TC Annotation as retrieved from the NCBI’s non-redundant NR database
SEQUENCE Sequence of the oligonucleotide probe

Data table
ID SPOT_ID GB ID Annotation SEQUENCE
1 TC169966 |BE435573|BG734675 1-aminocyclopropane-1-carboxylate oxidase gtgtgtgattgttgtgtggtattttaaagggttctaaagc
2 TC169967 |AW035744|BP907805|BI206463 nitrate reductase ggaggaactattggtgttctaaattggatggtgatgatga
3 TC169964 NP651452|AF447452|AAO72744.1NP405745|AF311943|AAL26804.1 galactinol synthase tgtgaacagatgttggaacagcactctatggaaattat
4 TC169965 |AW648330|AW648469|BP875801 pto-like serine threonine kinase tgccctatatctttcagagatgatgagttctgatgatga
5 TC169962 |BI924039|BG626095|BG126690 ascorbate peroxidase tctacagtgcagcaaaattgcgattttcttaatcctttc
6 TC169963 |CK714807|AI779132 cytochrome f tggccgaaatgaatttctagattcgcagatttatcga
7 TC169961 |BM956661 peroxidase actgattgtaagagggttaattagttgattaggaggggtt
8 TC169968 |AW038055NP211472|S37645|AAC60539.2NP000811|M83211|AAA34134.1NP000526|M67474|AAA34135.1NP602334|X55884|CAA39370.1 acid phosphatase ccaaaagtgttgatttgggagatgatggaagagatgtgtg
9 TC169969 |BI423085 cytochrome c heme attachment protein tggatatgctattttggggtcaatctattaggaatagggt
10 TC190207 |AW944890|AI780836|CN384693 ---NA--- actgcctgttaatactgtcaagtctcattctgaagatca
11 TC190206 |BP908505|BP906680|BP908043 ---NA--- aggacatagaaggccttcttgagtattatggtttctcat
12 TC190205 |BE462110|BP908028 protein ctaggatgttggaggtctcaagggaggaggctgag
13 TC190204 |BP877174|BP908448 protein ttatgggaacgacgaattttgaatgtgaccaccca
14 TC190203 |BP878251 heat shock protein 101 catacatcttctttcgtgacaggtgaggaagcaattta
15 TC190202 |BG626529|AW039286|BP882588 far-red impaired responsive family protein far1 family protein atgtcggatagcttgtttagccttttcccctttctttcca
16 TC181188 |BF098088|BM413555|AJ784586 protein gggaagatgaaaggcaatagagaggtggaatcaag
17 TC181189 |BE459543 reticulon family protein tcttcaaggtagttattgttctgtggcttctatctgtcat
18 TC181186 |DN168864|AW222231 at5g63860 mgi19_6 ctcagatatcaggtggttggagacataccatggcactta
19 TC181187 |BE460556|AW931211|AW038122 sac3 ganp familyexpressed tgaaggaatgggatgtagcatctttctgcaaagac
20 TC181184 |BP886458|BI922652 rna pseudouridylate synthase domain containing 2 tacaatgctcgagaagggaggagcacagttgaggt

Total number of rows: 20201

Table truncated, full table size 1995 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap